Unlock instant, AI-driven research and patent intelligence for your innovation.

Anti-PD1 monoclonal antibody, pharmaceutical composition and uses thereof

A monoclonal antibody, antibody technology, applied in the field of tumor treatment and molecular immunology, can solve problems such as liver damage

Active Publication Date: 2017-07-25
CTTQ AKESO (SHANGHAI) BIOMED TECH CO LTD
View PDF4 Cites 48 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PD1 plays a very important role in the process of negatively regulating the activation of T cells. The negative regulation of T cells mediated by PD1 can reduce the tissue damage caused by the promotion of infection, but blocking or inhibiting the negative regulation of PD1 can Lead to autoimmune diseases, for example, PD1 knockout mice can more effectively clear pancreas virus infection, but lead to more severe liver damage (Isai et al., 2003, J.Exp.Med.198:39- 50)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-PD1 monoclonal antibody, pharmaceutical composition and uses thereof
  • Anti-PD1 monoclonal antibody, pharmaceutical composition and uses thereof
  • Anti-PD1 monoclonal antibody, pharmaceutical composition and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0116] Example 1: Obtaining of hybridoma cell line LT003 and preparation of monoclonal antibody 14C12

[0117] 1. Establishment of hybridoma cell line LT003

[0118] Using PD1-mFc (PD1: Programmed cell death protein 1, NCBI GenBank ID: NP_005009.2) fusion protein as an antigen, the splenocytes and mouse myeloma cells from immunized BALB / C mice (purchased from Guangdong Medical Experimental Animal Center) were collected. Cells are fused into hybridoma cells, referring to currently established methods (for example, Stewart, S.J., "Monoclonal Antibody Production", in Basic Methods in Antibody Production and Characterization, Eds.G.C.Howard and D.R.Bethell, Boca Raton: CRC Press, 2000) .

[0119] Using PD1-mFc as an antigen to coat the microtiter plate, performing indirect ELISA screening, and obtaining hybridoma cells secreting new antibodies specifically binding to PD1.

[0120] A hybridoma cell line that can secrete a monoclonal antibody that competes with the ligand PDL1-h...

Embodiment 2

[0124] Example 2: Obtaining the Light Chain and Heavy Chain Sequences of Monoclonal Antibody 14C12

[0125] The mRNA was extracted from the hybridoma cell line LT003 prepared in Example 1 according to the method of the Bacteria Total RNA Extraction Kit (Tiangen, Cat. No. DP430) for cultured cells.

[0126] According to Invitrogen III First-Strand Synthesis System for RT-PCR Kit Instructions Synthesize cDNA and perform PCR amplification.

[0127] The PCR amplification product was directly cloned by TA, and the specific operation was performed referring to the instructions of the pEASY-T1 Cloning Kit (TransgenCT101) kit.

[0128] The products of TA clones were directly sequenced, and the sequencing results were as follows:

[0129] DNA sequencing results of heavy chain variable region: (354bp)

[0130] GAGGTCAAACTGGTGGAGAGCGGCGGCGGGCTGGTGAAGCCCGGCGGGTCACTGAAACTGAGCTGCGCCGCTTCCGGCTTCGCCTTTAGCTCCTACGACATGTCATGGGTGAGGCAGACCCCTGAGAAGCGCCTGGAATGGGTCGCTACTATCAGCGGAGGCGGGCGATACA...

Embodiment 3

[0142] Example 3: Design of heavy chain and light chain sequences of humanized antibody 14C12H1L1

[0143] 1. Design of light chain and heavy chain sequences of humanized antibody 14C12H1L1

[0144] According to the three-dimensional crystal structure of the PD1 protein (Shinohara T, et al., Structure and chromosomal localization of the human PD1 gene (PDCD1). Genomics1995,23(3):704-6) and the sequence of the antibody 14C12 obtained in Example 2, by The antibody model was simulated by computer, and mutations were designed according to the model to obtain the variable region sequence of antibody 14C12H1L1 (heavy chain constant region is Ig gamma-1 chain C region, ACCESSION: P01857, light chain constant region is Ig kappa chain C region, ACCESSION: P01834 ), the variable region sequence is as follows:

[0145] DNA sequence of heavy chain variable region: (354bp)

[0146] GAAGTGCAGCTGGTCGAGTCTGGGGGAGGGCTGGTGCAGCCCGGCGGGTCACTGCGACTGAGCTGCGCAGCTTCCGGATTCGCCTTTAGCTCCTACGACATGTCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of tumor treatment and molecular immunology, and relates to an anti-PD1 monoclonal antibody, a pharmaceutical composition and uses thereof. In particularly, the present invention relates to a monoclonal antibody or an antigen-binding fragment thereof, wherein the heavy chain variable region of the monoclonal antibody comprises CDR having an amino acid sequence represented by SEQ ID NO:9-11, and / or the light chain variable region of the monoclonal antibody comprises CDR having an amino acid sequence represented by SEQ ID NO:12-14. According to the present invention, the monoclonal antibody can well and specifically bind to PD1, can specifically release the immunosuppression of PD1 on body, and can activate T lymphocytes.

Description

technical field [0001] The invention belongs to the fields of tumor treatment and molecular immunology, and relates to an anti-PD1 antibody, its pharmaceutical composition and its application. Specifically, the present invention relates to an anti-PD1 monoclonal antibody. Background technique [0002] The transmembrane receptor PD1 (programmed cell death 1, also referred to as PD-1) is a member of the CD28 gene family, which is expressed in activated T cells, B cells and myeloid cells. Both PDL1 and PDL2, the receptors of PD1, belong to the B7 superfamily. PDL1 is expressed in many cells, including T cells, B cells, endothelial cells and epithelial cells, while PDL2 is only expressed in antigen-presenting cells such as dendritic cells and giant cells. Phage cells. [0003] T cells play a very important role in clearing viral infections, but T cell antiviral responses are often associated with immunopathology. PD1 plays a very important role in the process of negatively re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28C12N15/13C12N5/20G01N33/68G01N33/577A61K39/395A61P35/00A61P35/02
CPCC07K16/2818C07K2317/24C07K2317/565C07K2317/76C07K2317/92A61K2039/505A61K39/395C07K16/28G01N33/577G01N33/68A61P35/00A61P35/02A61P7/06G01N33/574G01N2333/70521G01N2800/7019
Inventor 李百勇夏瑜王忠民张鹏
Owner CTTQ AKESO (SHANGHAI) BIOMED TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More