sgRNA for promoting development of cotton lateral root and application thereof

A cotton and lateral root technology, applied in the field of plant genetic engineering, can solve problems such as inability to effectively verify sgRNA activity, difficulty in cotton protoplasts, and no cotton found, so as to improve stress resistance, increase root surface area, and improve absorption and utilization. Effect

Active Publication Date: 2017-08-15
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF3 Cites 41 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the high content of pigments and polyphenols in cotton, it is difficult to obtain cotton protoplasts, and the transformation efficiency is low. It cannot effectively verify whether the sgRNA has the activity of guiding Cas9 enzyme for gene editing, which limits the application of CRISPR / Cas9 technology in cotton. application
[0006] After searching, no reports were found on the use of CRISPR / Cas9 technology to regulate the development of cotton lateral roots

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • sgRNA for promoting development of cotton lateral root and application thereof
  • sgRNA for promoting development of cotton lateral root and application thereof
  • sgRNA for promoting development of cotton lateral root and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1 Obtaining of Cotton Arginase (ARG) Gene GhARG Target Sequence

[0066] Use the NCBI online database to search for the cotton arginase gene GhARG and download it. According to the sgRNA design method of Wagner JC et al. The target sequence was designed for each exon sequence, and optimized according to the target site, the number of mismatched bases, and the mismatched position, and a total of two target sequences were obtained, which were named sgRNA1 and sgRNA2 ( figure 1 ).

[0067] sgRNA1: 5'-TCTTACCCTTATTCGGGAGA-3' (SEQ ID No.1);

[0068] sgRNA2: 5'-CTTTGCCCTCTCCCGAATAA-3' (SEQ ID No. 2).

Embodiment 2

[0069] Example 2, CRISPR / Cas9 gene editing system expression vector construction

[0070] Proceed as follows:

[0071] (1) The tobacco NtU6 promoter was added to the 3' end of the sgRNA1 sequence obtained in Example 1, and the hairpin structure and terminator sequence combined with the Cas9 enzyme were added to the 5' end to form a complete expression cassette. According to the enzyme cutting site of the vector pBI121, an additional 4 bases TCGA was introduced at the 5' end of the expression cassette to obtain sequence 3 (see SEQ ID No.3), and sequence 3 (SEQ ID No.3) was reversely complementary to obtain For the reverse sequence of sgRNA1, 4 bases CTAG were introduced at the 5' end of the reverse sequence to obtain sequence 4 (see SEQID No.4).

[0072] Sequence 3:

[0073] 5'-TCGACATAGCGATTGTCTTACCCTTATTCGGGAGAGTTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (SEQ ID No. 3)

[0074] Sequence 4:

[0075] 5'-CTAGAAAAAAAGCACCGACTCGGTGCCA...

Embodiment 3

[0092] Embodiment 3, the acquisition of cotton transgenic plant

[0093] Including the following steps:

[0094] 1. The expression vector pBIGFP-Cas9-sgRNA1 obtained in Example 2 was introduced into Agrobacterium GV3101 (Agrobacterium GV3101 was provided by the Institute of Biotechnology, Chinese Academy of Agricultural Sciences) to obtain Agrobacterium containing the gene editing expression vector. The specific steps are as follows: Add 10 ng of the expression vector pBIGFP-Cas9-sgRNA1 obtained in Example 1 into 100 μL of Agrobacterium GV3101 competent, place on ice for 30 minutes, freeze in liquid nitrogen for 10 minutes, heat shock at 42°C for 90 seconds, and place on ice for 3 minutes; add 700 μL of liquid YEB medium was cultured on a shaker at 28°C and 200 rpm for 6 hours to recover the bacteria. Use a pipette to insert onto solid YEB medium containing spectinomycin and kanamycin resistance, and culture at 28°C for 2 days. A single colony was picked and cultured in 500u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses sgRNA for promoting development of cotton lateral root, a target sequence of sgRNA is respectively composed of the nucleotide sequences shown in SEQ ID No.1 or SEQ ID No.2, and two target sequences can be used by combination. The expression of cotton argininase gene can be inhibited through a CRISPR / Cas9 gene editing system. Compared with wild type plants, the lateral root number of the gene editing plants obtained by silencing the cotton argininase gene is obviously increased, the root surface area is obviously increased, No content is increased, absorption and utilization of nitrogen element and other nutrients by cotton are increased, and sgRNA has important meaning for increasing the cotton fiber output and quality as well as increasing the cotton stress resistance.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to an sgRNA capable of promoting the development of cotton lateral roots, and also relates to a method for promoting the development of cotton lateral roots using CRISPR / Cas9 gene editing technology. Background technique [0002] Plant roots play an important role in physiological activities such as plant water and nitrogen uptake, carbon storage, and supporting aboveground parts; at the same time, plant roots are also important functional organs for plants to respond to biotic and abiotic stresses. The root system of cotton is a typical tap root system, including tap root and lateral root. The development of lateral roots plays an important role in the function of the root system. The increase in the number of lateral roots can increase the root surface area, further promote the development of the whole plant, and finally achieve the purpose of increasing cotto...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/82C12N9/22A01H5/00
CPCC12N9/22C12N9/78C12N15/1137C12N15/8213C12N15/8261C12N2800/60C12N2810/10C12N2830/34C12N2830/36C12Y305/03001
Inventor张锐孟志刚郭三堆王艳玲梁成真朱涛王远
OwnerTHE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI