Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Protein of transcription factor NAC062D and application of encoding gene thereof in inhibiting seed germinating

A technology of transcription factors and coding genes, which can be used in applications, genetic engineering, plant genetic improvement, etc.

Active Publication Date: 2017-08-18
GUIZHOU NORMAL UNIVERSITY
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] 1. It is said that genetically modified seeds cannot be saved, but only fresh genetically modified seeds can be bought, and genetically modified seeds are only sold exclusively by people who study genetically modified genes.
[0004] 2. For example, when soybeans need to be transformed into bean sprouts, genetic modification cannot be done, and non-GMO that can be transformed into bean sprouts must be purchased.
[0005] With the increasing environmental pollution, the greenhouse effect intensifies, the surface temperature rises, the temperature changes abnormally in four seasons, and the haze weather continues to occur, which seriously affects the growth and development of crops, and then affects food production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein of transcription factor NAC062D and application of encoding gene thereof in inhibiting seed germinating
  • Protein of transcription factor NAC062D and application of encoding gene thereof in inhibiting seed germinating
  • Protein of transcription factor NAC062D and application of encoding gene thereof in inhibiting seed germinating

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0033] The specific implementation, features and efficacy of the NAC062D transcription factor protein and its encoding gene proposed in the present invention in inhibiting seed germination are described in detail below in conjunction with the accompanying drawings, sequence listing and preferred embodiments.

[0034] The test methods used in the implementation are conventional methods unless otherwise specified; the materials and reagents used can be obtained from commercial sources unless otherwise specified.

[0035] 1. Obtaining of NAC062D-transformed yeast strain:

[0036] (1) Cloning of regulatory genes:

[0037] The primer sequences designed for transcription activation activity are as follows:

[0038] Upstream of P1: CCGAATTCATGAATCAGAATCTTCATGT

[0039] Downstream of P2: AGAGATCTTGCTACAACATCAAAACCAC

[0040] Use the plant RNA extraction kit (Tiangen) and refer to the instructions to extract the total RNA of wild-type Arabidopsis (Columbia ecotype, purchased from th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to protein of a transcription factor NAC062D. The transcription factor is an active form after a transmembrane domain is removed from a membrane-associated transcription factor NAC062, an amino acid sequence is a sequence 1 in a sequence table, and a nucleotide sequence is a sequence 2 in the sequence table. A transgenic plant culture method of importing an encoding gene of the protein of the transcription factor NAC062D into a target plant is used for importing the encoding gene of the protein of the NAC062D into the target plant, so as to obtain the transgenic plant. The transgenic plant has the features that (1) under the normal condition, the transgenic plant is basically the same with the non-transgenic plant; (2) by adding 10mu M of inducing agent beta-estrodial (beta-E), the germinating rate of the transgenic plant is lower than the germinating rate of the non-transgenic plant. The function of the transgenic plant inhibiting the seed germinating is expressed by that the germinating rate of the transgenic plant is lower than the germinating rate of the target plant. The transcription factor NAC062D for regulating and controlling the germinating of the plant seeds and the encoding gene thereof are imported into arabidopsis thaliana (ecotype columbia), and the transgenic plant is obtained, so that the transcription factor can be applied to regulate and control the seed germinating.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an active form NAC062D protein of a membrane-bound transcription factor NAC062 and the application of its coding gene in inhibiting seed germination. Background technique [0002] Monsanto researchers cloned the resistance gene (EPsPs gene) from petunia, and applied the plasmid-mediated transfer deoxyribonucleic acid (DNA) technology to transfer the EPsPs gene controlled by the 35s promoter in the petunia plasmid (caMv) Introduced into the soybean genome, and then bred glyphosate-resistant soybean varieties. This genetically modified soybean was approved by the U.S. Food and Drug Administration (FDA) in 1994 and became one of the earliest commercialized large-scale production of genetically modified crops. RR soybeans are highly tolerant to the non-selective herbicide Roundup (Rwndup) due to the herbicide glyphosate tolerance gene. Application of glyphosate herbicide in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/10
CPCC07K14/415C12N15/8267
Inventor 杨正婷乙引李琨龚记熠
Owner GUIZHOU NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products