Genetically engineered bacterium for expressing heat resistant type dextransucrase, as well as construction method and application of genetically engineered bacterium

A technology of dextran sucrose and genetically engineered bacteria, applied in genetic engineering, microbe-based methods, plant genetic improvement, etc., can solve problems such as reaction rate and process temperature influence, and achieve the effect of saving production capital

Inactive Publication Date: 2017-09-26
HEFEI UNIV OF TECH
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Also, more stable enzymes may have a positive impact on reaction rates, process temperatures

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium for expressing heat resistant type dextransucrase, as well as construction method and application of genetically engineered bacterium
  • Genetically engineered bacterium for expressing heat resistant type dextransucrase, as well as construction method and application of genetically engineered bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Construction of recombinant expression plasmid pET28a(+) / dex-YG

[0040] According to the dextran sucrase gene (dexYG) sequence obtained by cloning, according to the sequence characteristics of the expression vector pET28a (+), the primers were designed as follows by means of Primer Premier 5.0 software:

[0041] Forward primer: 5'CGC GGATCC ATGCCATTTACAGAAAAAGT 3', (contains a BamHI site);

[0042] Reverse primer: 5'CCC AAGCTT TTATGCTGACACAGCATTT3', (contains a HindIII site).

[0043] Using the cloned dextran sucrase gene (dexYG) as a template, PCR amplification technology was used to obtain gene clone products containing BamHI and HindIII restriction sites. The PCR product recovery procedure is as follows:

[0044] 1. Cut out the target DNA band in the agarose gel, put it into a clean centrifuge tube and weigh it. If the gel weighs 100mg, it can be regarded as 100μL (100mg≈100μL).

[0045] 2. Add three times the volume of solution GSB, melt the glue in...

Embodiment 2

[0052] Example 2: Construction of genetically engineered bacteria dex-YG-thMU01 expressing thermostable dextran sucrase

[0053] The recombinant expression plasmid pET28a(+) / dex-YG was transformed into E.coli BL21(DE3) competent cells, and after kanamycin resistance screening and enzyme digestion verification, the dextran sucrase engineered strain E. Coli BL21(DE3) / pET28a(+) / dex-YG. Extract its plasmid as a template, and perform site-directed mutation on the recombinant plasmid. First, mutate proline at position 473 to serine to obtain a single mutant P473S, extract its plasmid as a template, and then mutate proline at position 856 to serine , obtained the double mutant P473S / P856S, transformed it into E.coli BL21 (DE3) competent cells, and obtained the genetically engineered strain dex -YG-thMU01, the primers for the double mutant were designed as follows:

[0054] P473S forward primer: 5'AACAGTCCACTGACA T CTGATGCTA 3';

[0055] P473S reverse primer: 5' A TGTCAGTGGACTGTT...

Embodiment 3

[0069] Example 3: Expression of heat-resistant recombinant engineered bacteria dex-YG-thMU01 dextran sucrase

[0070] The recombinant engineered strain dex-YG-thMU01 was inoculated into liquid LB medium containing 50 μg / mL kanamycin and cultured at 37°C for 16-18 hours, then transferred to liquid A medium and cultured at 37°C, when diluted 10 OD after times 600 When it reached 0.25, 1 mmol / mL IPTG was added for induction, and samples were taken every 1 hour for a total of 5 times, and the samples were analyzed by SDS-PAGE electrophoresis. Among them, the amount of enzyme was more in the 4th to 5th hour, and the molecular weight of the expressed dextrose-sucrase protein was consistent with the predicted value (about 170kDa).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetically engineered bacterium for expressing heat resistant type dextransucrase, as well as a construction method and application of the genetically engineered bacterium. The genetically engineered bacterium for expressing the heat resistant type dextransucrase is constructed as follows: a dex-YG gene obtained by cloning is inserted into an expression vector pET28(+)a, so as to obtain a recombinant expression plasmid pET28(+) / dex-YG which is taken as a template; site-directed mutagenesis is performed on a 473-site and a 856-site, heat-resistant double-mutants P473S / P856S with high enzyme activity is obtained after screening, and a recombinant engineered bacterium dex-YG-thMu01 is obtained from the conversion of a host bacterium E.ColiBL21(DE3). The genetically engineered bacterium dex-YG-thMu01 disclosed by the invention have the characteristics of heat resistance and high enzyme activity, and provide a certain basis for application of the genetically engineered bacterium dex-YG-thMu01 to industrial production of the dextransucrase; the productive capital can be saved.

Description

technical field [0001] The invention relates to a genetically engineered bacterium and its expression method and use, in particular to a genetically engineered bacterium expressing heat-resistant dextran sucrase and its construction method and use. Background technique [0002] Dextran, also known as dextran, is a high molecular weight glucose polymer produced after sucrose is fermented by Leuconostoc membranaceus, which is mainly connected by glucosyl α(1-6) glycosidic bonds. Because of its many advantages such as safety, non-toxicity and good biocompatibility, it has been widely used in many fields such as medicine, food and chromatographic analysis. Dextran and its derivatives are widely used in many industries such as medicine, food, and chemical industry, and the market demand is huge (the global annual demand is nearly tens of billions of dollars). Dextran 70 fermented by Leuconostoc is currently recognized as an excellent plasma substitute, and dextran fermented by b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/56C12N15/70C12N9/10C12P19/08C12R1/19
CPCC12N9/1048C12N15/70C12P19/08
Inventor张洪斌李梦绮李瑶胡雪芹杨静文
OwnerHEFEI UNIV OF TECH