Recombinant pseudorabies virus for expressing S1 proteins of porcine epidemic diarrhea viruses, construction method and application thereof

A technology of porcine epidemic diarrhea and pseudorabies virus, which is applied in the direction of viruses, applications, antiviral agents, etc., and can solve problems such as changes

Active Publication Date: 2017-11-14
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

S gene sequence analysis showed that before 2010, the S gene sequence of the PEDV strain was highly homologous to the British standard strain CV777 (AF353511), reaching 98%. After 2010, 27 S gene sequences from 9 pig farms were compared and analyzed , the result is that only 8 S gene sequences of 3 pig farms are homologous to CV777, and 19 S gene sequences of 7 pig farms are homologous to PEDV Korean isolate (DQ862099.1), and the homology with CV777 is only about 85% , there are gene insertions and deletions, and changes in the PEDV gene sequence may have led to changes in its prevalence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant pseudorabies virus for expressing S1 proteins of porcine epidemic diarrhea viruses, construction method and application thereof
  • Recombinant pseudorabies virus for expressing S1 proteins of porcine epidemic diarrhea viruses, construction method and application thereof
  • Recombinant pseudorabies virus for expressing S1 proteins of porcine epidemic diarrhea viruses, construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Optimization of PEDV S1 gene

[0049] The codon of PEDV S1 gene was optimized and synthesized by Nanjing GenScript Biotechnology Co., Ltd., and cloned into the pUC57 plasmid vector. The optimized PEDV-S1 (2325bp) gene added BamHI restriction site GGATTC and Kozak sequence GCCACC to the 5' end, and EcoRI restriction site GAATTC and flag tag GATTACAAGGATGACGACGATAAG to the 3' end. The nucleotide sequence of the optimized PEDV-S1 gene is shown in SEQ ID NO.1 of the sequence table.

Embodiment 2

[0050] Example 2 Verification of the expression of S1 protein

[0051] 1. Construction of eukaryotic expression plasmid pEP-S1-END

[0052] 1.1 Digestion of recombinant plasmid pUC57-S1 and eukaryotic expression vector

[0053] The recombinant plasmid pUC57-S1 and the eukaryotic expression vector pEP-BGH-end were double-digested with BamHI and EcoRI, respectively. The restriction system is shown in Table 2.

[0054] Table 2 enzyme digestion system

[0055]

[0056] Digested in a water bath at 37°C for 5 hours, and the digested products were electrophoresed on a 1.0% agarose gel to analyze the effect of the digested enzyme, and then the target fragments were purified and recovered with a gel recovery kit.

[0057] 1.2 Connection of expression vector and target gene

[0058] The purified target gene and expression vector were ligated with T4 DNA Ligase to construct the recombinant expression plasmid pEP-S1-END. The ligation reaction system is as follows:

[0059]

[00...

Embodiment 3

[0083] Example 3 Construction of recombinant PRV expressing PEDV S1

[0084] 1. Pcmv promoter replacement of PRV-Bac ZJ strain

[0085] 1.1 Preparation of pEP-EF1-in plasmid

[0086] Streak the PRV-Bac ZJ strain on a Kan-resistant plate and culture it at 37°C for 18 hours to obtain its pure culture. A single colony was picked from the pure culture, inoculated into 3 mL of LB culture medium containing Kan resistance, and cultured with shaking at 220 r / min at 37 °C for 16 h to extract the pEP-EF1-in plasmid (the plasmid map is shown in Figure 5).

[0087] 1.2 PCR amplification of homologous recombination sequences with I-Sce I-Kan and EF1

[0088] With the extracted pEP-EF1-in plasmid as a template, use primer pair EF1-epF / EF1-epR (its nucleotide sequence is as shown in sequence table SEQ ID NO.8 and SEQ ID NO.9) amplification containing I- DNA fragment I-Sce I-Kan-EF1 of Sce I-Kan and EF1.

[0089] The PCR reaction system (total volume 25 μL) is: 5×PrimeSTAR Buffer 5 μL, dN...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant pseudorabies virus for expressing S1 proteins of porcine epidemic diarrhea viruses. The virus is inserted into S1 genes of optimized porcine epidemic diarrhea viruses, and the nucleotide sequence of the recombinant pseudorabies virus is shown in SEQ ID NO.1 of a sequence table. The invention further discloses a construction method of the recombinant pseudorabies virus and an application thereof in preparing animal vaccines. The recombinant pseudorabies virus is good in safety, and after immunization, the recombinant pseudorabies virus not only can generate antibodies for the mutant pseudorabies virus, but also can generate S1 protein antibodies for the porcine epidemic diarrhea viruses, so that the market prospect is wide.

Description

technical field [0001] The present invention relates to the field of biotechnology. More specifically, it relates to a recombinant pseudorabies virus expressing porcine epidemic diarrhea virus S1 protein and its construction method and application. Background technique [0002] Porcine epidemic diarrheal disease is an epidemic disease. According to statistics from the Epidemiology Center of the Ministry of Agriculture, the number of pig deaths caused by porcine epidemic diarrhea (PED) disease has occupied the first place in the existing pig diseases in recent years. The survey results showed that the incidence rate of suckling piglets in the diseased field was between 10% and 100%, and the fatality rate was between 40% and 92.58%. According to incomplete statistics, the mortality rate of the disease accounts for about 3% to 5% of the total number of herds and brings huge economic losses to the pig industry. [0003] PEDV belongs to the family Coronaviridae and the genus C...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/01C12N15/869A61K39/245A61K39/215A61P31/14A61P31/22
CPCA61K39/12A61K2039/552A61K2039/70C12N7/00C12N15/86C12N2710/16734C12N2710/16743C12N2770/20022C12N2770/20034
Inventor袁秀芳余斌徐丽华李军星苏菲王一成
OwnerZHEJIANG ACADEMY OF AGRICULTURE SCIENCES