Porcine epidemic diarrhea virus attenuated vaccine strain and its culture method and use

A porcine epidemic diarrhea and attenuated vaccine technology, which is applied in the field of porcine epidemic diarrhea virus attenuated vaccine, can solve the problems of poor treatment effect, poor immunogenicity, and difficulty in prevention, so as to prevent porcine epidemic diarrhea and prevent infection Effect

Inactive Publication Date: 2017-04-26
BEIJING DAWEIJIA BIOTECH SHARE CO LTD
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there is no specific drug for the treatment of porcine epidemic diarrhea, and the effect of conventional treatment is not good. Therefore, vaccine prevention is still the main method. Although commercial vaccines for porcine epidemic diarrhea have been used in pigs, the virus still appears in the In immunized pigs, it has brought great difficulties to the prevention of the disease. According to a large number of domestic and foreign experts' research, it is preliminarily judged that it is related to the mutation of the virus strain. The continuous mutation of the wild strain has caused the deterioration of the immunogenicity. Therefore, a New vaccine strains with high immunogenicity and high safety of circulating strains are of great significance for the prevention of porcine epidemic diarrhea

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine epidemic diarrhea virus attenuated vaccine strain and its culture method and use
  • Porcine epidemic diarrhea virus attenuated vaccine strain and its culture method and use
  • Porcine epidemic diarrhea virus attenuated vaccine strain and its culture method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Attenuation of Porcine Epidemic Diarrhea Virus

[0034] 1. Attenuated cultivation of porcine epidemic diarrhea virus

[0035] The isolated porcine epidemic diarrhea virus was continuously passaged on Vero cells for 120 generations. During this process, it was continuously cloned and purified for 3 times, and then continued to be passaged on Vero cells for 150 generations. The 0-, 30-, 50-, 80-, 120- and 150-generation viruses were tested by RT-PCR, and the S gene and ORF3 gene sequences were amplified for analysis. The primers for amplifying the ORF3 gene sequence were: ORF3F5'CTAGACTTCAACCTTACGAA 3', ORF3R 5'TACTAGACCATTATCATTCACT 3', and the fragment size of the amplified ORF3 gene was 734 bp ( Figure 7 ). The amplified S gene sequence is divided into 4 sections for amplification, and the primers are: primer S1F 5'TAGTGATGTTGTGTTAG 3', see SEQ ID No:2; S1R 5'CGCTGCACAGCAGCTC 3', SEQ ID No:3; S2F5'CATACCAGAAGGTTTTAG 3' , see SEQ ID No: 4; S2R 5' GTAATCAAC...

Embodiment 2

[0054] Example 2 Safety Evaluation of Porcine Epidemic Diarrhea Virus Attenuated Strain NB120

[0055] Dilute NBF120 virus to 10 6.0 TCID 50 / ml (10 piglets), 10 piglets at the age of 5 days, were randomly divided into two groups, 5 piglets in the inoculation group, each piglet was orally administered with 2ml, and 5 piglets in the control group were injected with the same dose of DMEM, and observed for 14 days; 5 pregnant sows were given 4ml orally, and 5 sows in the control group were injected with the same dose of DMEM; the sows' food intake, energy, vomiting, diarrhea, abortion and sow litter size were observed.

[0056] The result proves that large-dose oral inoculation of the attenuated strain has no effect on piglets and sows, and there is no incidence of vomiting and diarrhea. The sows did not suffer from reproductive impairment symptoms such as miscarriage and stillbirth, and there was no significant difference in litter size between the experimental group and the c...

Embodiment 3

[0058] Embodiment 3 Porcine epidemic diarrhea virus attenuated strain NB120 immune efficacy evaluation

[0059] One active immunization test

[0060] 40 5-day-old piglets were selected, and the PEDV neutralizing antibody was less than 1:8, and they were divided into ABC three groups on average, AB was the immunization group, and C group was the control group. Group A took PEDV NBF120 1ml orally (virus content 10 5.0 TCID 50 / ml); Group B intramuscular injection of attenuated PEDV vaccine strain CV777 1ml (virus content 10 5.0 TCID 50 / ml); Group C took the same dose of DMEM orally. After 14 days of inoculation, the immunized group and the control group were given porcine epidemic diarrhea virus virulence (10 5.0 TCID 50 / ml) 1ml, observe for 7 days, and count the incidence of each group.

[0061] 14 days after the virus inoculation, the test pigs were all normal, and the challenge protection results of each group are shown in Table 7. It can be seen from the table that ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a porcine epidemic diarrhea virus attenuated vaccine strain. The porcine epidemic diarrhea virus attenuated vaccine strain is an attenuated vaccine obtained by PEDV / CH / NB / 2014 passage attenuation and has an accession number of CGMCC No. 13299. The invention also discloses a use of the attenuated vaccine strain NB120 in prevention of porcine epidemic diarrhea diseases and the use belongs to the field of biotechnology. The attenuated vaccine strain NB120 can be processed to form a single vaccine or a multi-vaccine and the vaccine can effectively prevent porcine epidemic diarrhea diseases. The attenuated vaccine strain NB120 has the advantages of good safety and good immunogenicity. After applying to a sow or piglet, the vaccine strain can produce protective immune response to a prevalent strain of porcine epidemic diarrhea virus and thus the vaccine strain can effectively prevent infection caused by the prevalent strain of porcine epidemic diarrhea virus, can reduce a disease loss and has a good application prospect.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a porcine epidemic diarrhea virus attenuated vaccine and its application. Background technique [0002] Porcine epidemic diarrhea (PED) is an acute, highly contagious enteric infectious disease caused by porcine epidemic diarrhea virus (PEDV), characterized clinically by watery diarrhea, vomiting, and dehydration . Pigs of all ages are susceptible, especially suckling piglets. PED is widely distributed in the world, the United Kingdom, Belgium, France, Hungary, Canada and other countries have reported the occurrence of this disease. According to reports, PED has occurred quite seriously in Asian countries in recent years. Japan, South Korea, and Thailand have all experienced pandemics, with high mortality and serious harm, causing huge economic losses to the pig industry. [0003] At present, there is no specific drug for the treatment of porcine epidemic diarrhea, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/00C12N7/08A61K39/215A61P31/14
CPCA61K39/12A61K2039/5254A61K2039/552C12N7/00C12N2770/20021C12N2770/20034C12N2770/20064
Inventor闫雷张晓杰张美美金忠辉侯艳红李爽乔琳
OwnerBEIJING DAWEIJIA BIOTECH SHARE CO LTD