Fusion protein and application thereof
A fusion protein and protein technology, which can be used in fusion polypeptides, hybrid peptides, veterinary vaccines, etc., can solve the problems of economic loss, difficulty in isolating and culturing PEDV whole virus, and high morbidity and mortality. Ease of mass production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0022] As an embodiment of the present invention, the porcine epidemic diarrhea virus antigenic protein includes porcine epidemic diarrhea virus S protein and / or its fragments.
[0023] As an embodiment of the present invention, the porcine epidemic diarrhea virus antigenic protein may further include porcine epidemic diarrhea virus S1 protein, M protein, N protein and / or fragments thereof.
[0024] As an embodiment of the present invention, the monomeric ferritin subunit protein includes bacterial ferritin, plant ferritin, algal ferritin, insect ferritin, fungal ferritin and mammalian ferritin.
[0025] As an embodiment of the present invention, the monomeric ferritin subunit protein is Helicobacter pylori ferritin; wherein, the monomeric ferritin subunit protein is optimized Helicobacter pylori ferritin; wherein, the optimized The Helicobacter pylori ferritin nucleotide sequence encodes the amino acid sequence of SEQ ID NO.2.
[0026] As an embodiment of the invention, the ...
Embodiment 1
[0052] Embodiment 1 Preparation of fusion protein and nanoparticles containing fusion protein
[0053] 1.1 Preparation of Ferritin protein
[0054] Ferritin protein was directly synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. according to SEQ ID NO.1.
[0055] 1.2 Construction of pCDNA-ferri plasmid
[0056] The upstream primer FerriFP for the synthesis of Ferritin protein: 5'ACGAATTCGGTGGTTC
[0057] TGGTGGTGAGTCTCAGGTC3', downstream primer FerriRP: 5'GCTCTAGAT
[0058] CAGCTCTTTCCTGCTCTTGGC3'.
[0059] Using the upstream and downstream primers for the synthetic Ferritin protein, the Ferritin protein prepared in Example 1.1 was used as a template for PCR amplification. The PCR reaction conditions were pre-denaturation at 94°C for 2min-(denaturation at 94°C for 30s-annealing at 56°C for 30s-extension at 72°C for 1min) for 30 cycles--extension at 72°C for 7min. The obtained PCR product contains the Ferritin protein gene and is fused with a flexible protein linker o...
Embodiment 2
[0094] The preparation of embodiment 2 vaccine composition
[0095] Dilute the nanoparticles Sa-Nano, Sb-Nano, Sc-Nano, and Sd-Nano prepared in Example 1 with PBS at pH 7.4, and add aluminum gel adjuvant to mix well, so that the nanoparticles contained in the vaccine composition The content of the particles is shown in Table 3, while ensuring that the volume ratio of the aluminum gel adjuvant to the vaccine composition is 1:5. The prepared vaccine composition was used as an immunogen and stored at 4°C for future use.
[0096] Table 3 Components contained in porcine epidemic diarrhea vaccine composition
[0097]
PUM
| Property | Measurement | Unit |
|---|---|---|
| Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



