Supercharge Your Innovation With Domain-Expert AI Agents!

Fusion protein and application thereof

A fusion protein and protein technology, which can be used in fusion polypeptides, hybrid peptides, veterinary vaccines, etc., can solve the problems of economic loss, difficulty in isolating and culturing PEDV whole virus, and high morbidity and mortality. Ease of mass production

Active Publication Date: 2017-08-29
PU LIKE BIO ENG
View PDF9 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disease has a sudden onset, rapid spread, wide epidemic range, and long epidemic time. It is ineffective to use various antibiotics for prevention and treatment. Porcine Epidemic Diarrhea Virus Variant (Chen JF, Liu XZ, Shi D, et al. Complete Genome Sequence of a Porcine Epidemic Diarrhea Virus Variant. Journal of Virology, 2012, 86: 3408)
[0004] At present, the prevention and control of the disease mainly adopts traditional techniques to prepare inactivated vaccines for immunization, but the whole PEDV virus is difficult to isolate and culture.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein and application thereof
  • Fusion protein and application thereof
  • Fusion protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0022] As an embodiment of the present invention, the porcine epidemic diarrhea virus antigenic protein includes porcine epidemic diarrhea virus S protein and / or its fragments.

[0023] As an embodiment of the present invention, the porcine epidemic diarrhea virus antigenic protein may further include porcine epidemic diarrhea virus S1 protein, M protein, N protein and / or fragments thereof.

[0024] As an embodiment of the present invention, the monomeric ferritin subunit protein includes bacterial ferritin, plant ferritin, algal ferritin, insect ferritin, fungal ferritin and mammalian ferritin.

[0025] As an embodiment of the present invention, the monomeric ferritin subunit protein is Helicobacter pylori ferritin; wherein, the monomeric ferritin subunit protein is optimized Helicobacter pylori ferritin; wherein, the optimized The Helicobacter pylori ferritin nucleotide sequence encodes the amino acid sequence of SEQ ID NO.2.

[0026] As an embodiment of the invention, the ...

Embodiment 1

[0052] Embodiment 1 Preparation of fusion protein and nanoparticles containing fusion protein

[0053] 1.1 Preparation of Ferritin protein

[0054] Ferritin protein was directly synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. according to SEQ ID NO.1.

[0055] 1.2 Construction of pCDNA-ferri plasmid

[0056] The upstream primer FerriFP for the synthesis of Ferritin protein: 5'ACGAATTCGGTGGTTC

[0057] TGGTGGTGAGTCTCAGGTC3', downstream primer FerriRP: 5'GCTCTAGAT

[0058] CAGCTCTTTCCTGCTCTTGGC3'.

[0059] Using the upstream and downstream primers for the synthetic Ferritin protein, the Ferritin protein prepared in Example 1.1 was used as a template for PCR amplification. The PCR reaction conditions were pre-denaturation at 94°C for 2min-(denaturation at 94°C for 30s-annealing at 56°C for 30s-extension at 72°C for 1min) for 30 cycles--extension at 72°C for 7min. The obtained PCR product contains the Ferritin protein gene and is fused with a flexible protein linker o...

Embodiment 2

[0094] The preparation of embodiment 2 vaccine composition

[0095] Dilute the nanoparticles Sa-Nano, Sb-Nano, Sc-Nano, and Sd-Nano prepared in Example 1 with PBS at pH 7.4, and add aluminum gel adjuvant to mix well, so that the nanoparticles contained in the vaccine composition The content of the particles is shown in Table 3, while ensuring that the volume ratio of the aluminum gel adjuvant to the vaccine composition is 1:5. The prepared vaccine composition was used as an immunogen and stored at 4°C for future use.

[0096] Table 3 Components contained in porcine epidemic diarrhea vaccine composition

[0097]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides fusion protein, which comprises monomeric ferritin subunit protein connected to porcine epidemic diarrhea virus antigenic protein, which includes porcine epidemic diarrhea virus S protein and / or fragments thereof, and further includes S1 protein, M protein, N protein and / or fragments thereof. The invention further provides nanoparticles containing the fusion protein. The invention further provides a vaccine composition containing the nanoparticles and / or a carrier. The invention further discloses a preparation method of the vaccine composition and an application of the vaccine composition to prepare a medicine for preventing and / or treating porcine epidemic diarrhea virus. The vaccine composition made from the nanoparticles overcomes the technical problem that whole viruses are hard to separate and culture in a process of manufacturing a conventional inactivation vaccine from porcine epidemic diarrhea whole viruses. The nanoparticles can be subjected to massive recombinant expression via genetic engineering technology. The time consumption is short, and the fusion protein is convenient for massive production.

Description

technical field [0001] The invention belongs to the technical field of veterinary biological products, and in particular relates to a fusion protein of porcine epidemic diarrhea virus, nanoparticles containing the fusion protein, a vaccine composition containing the nanoparticle, and preparation and application thereof. Background technique [0002] Porcine epidemic diarrhea (porcine epidemic diarrhea, PED) is an important acute, contact, viral intestinal infectious disease caused by porcine epidemic diarrhea virus (porcine epidemic diarrhea virus, PEDV). Vomiting, dehydration, and decreased appetite are characteristic. The disease can occur in pigs of any age. The younger the age, the more severe the symptoms and the higher the mortality rate. In particular, newborn piglets within 7 days of age will die of severe dehydration 3-4 days after diarrhea occurs, and the mortality rate is as high as 50. %, the highest mortality rate is 100%. The disease first occurred in the Uni...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00A61K39/215A61K39/385A61P31/14C07K14/195
CPCA61K39/12A61K39/385A61K2039/552A61K2039/6068A61K2039/70C07K14/005C07K14/195C07K2319/00C12N2770/20022C12N2770/20034
Inventor 田克恭杨凡力胡旭乐孙进忠张许科
Owner PU LIKE BIO ENG
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More