Artificial site-directed mutant of paddy rice starch branching enzyme SBE3 gene and applications thereof

A technology of starch branching enzyme and rice, applied in the direction of genetic engineering, application, hydrolytic enzyme, etc.

Active Publication Date: 2017-11-24
SHANGHAI ACAD OF AGRI SCI
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for rice high resistant starch traits, especially the main gene SBE3 for the formation of rice high resistant starch traits, there is no relevant research or results in this regard.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificial site-directed mutant of paddy rice starch branching enzyme SBE3 gene and applications thereof
  • Artificial site-directed mutant of paddy rice starch branching enzyme SBE3 gene and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Selection of CRISPR / Cas9 Modified Targets

[0041] The entire genome sequence of SBE3 was scanned. The SBE3 gene has a total of 22 exons. The target sequence was located on the exon and as close as possible to the upstream as the selection criteria, and the selection of the target sequence was limited to the first 10 exons. It is required that the target sequence has an enzyme cleavage site to facilitate subsequent preliminary detection of mutation efficiency through enzyme cleavage.

[0042] Finally, after exclusion, it was determined that 3 target sequences were pre-selected, namely:

[0043] GTATCGAGAATGGGCTCCCG located in exon 5 of SBE3 gene (including SmaI restriction site);

[0044] GCAGGAGAAATCCCATACAA located in exon 8 of the SBE3 gene (including the Van91I / BseLI restriction site); and

[0045] TTCCAAAGAATCAAAAAAGCT located in exon 10 of the SBE3 gene (including the HinIII restriction site).

[0046] Since the exon 10 contains HindIII in addition ...

Embodiment 2

[0047] Example 2 CISPR / Cas9 vector construction and transgenesis

[0048] (1) Targeting sequence in exon 8 of SBE3 gene

[0049] The nucleotide sequence of exon 8 in the wild-type rice starch branching enzyme SBE3 gene sequence is shown in SEQ ID NO.3. The CRISPR / Cas9 modification target length is 20bp, located at bases 70-89 in exon 8, and the modification target sequence is GCAGGAGAAATCCCATACAA. The following oligonucleotides were synthesized against this targeting sequence:

[0050] SEQ ID NO.5 (SBE3-F3):

[0051] 5'-GTGTGCAGGAGAAATCCCATACAA-3'

[0052] SEQ ID NO.6(SBE3-R3):

[0053] 5'-AAACTTGTATGGGATTTCTCCTGC-3'

[0054] The sgRNA carrier OsU6-SK plasmid vector (see Zhengyan Feng et al., Efficient genome editing in plants using a CRISPR / Cas system, Cell Research (2013) 23:1229–1232; from Zhu Health Lab) was digested with BbsI, and the gel was carried out. Recycle. Add the synthesized upstream and downstream primers F3 and R3 into ddHO, dilute to 10 μmol mother so...

Embodiment 3

[0065] Example 3 Obtaining of CRISPR / Cas9T0 mutants

[0066] Yang Ruifang et al. used Jiangtangdao No. 1 as a high-RS gene donor material to hybridize with Miryang 23, Xiushui 123, and Hudao 55 with higher yields, and used the chalky grain characteristics of the early generations of the three hybrid populations, amylose Content (Amylasecontent, AC) and functional markers (CAPS / SpeI) for high RS rice assisted selection breeding. The research results show that the chalkiness of the grain is highly correlated with the RS content (Yang Ruifang et al., Molecular marker-assisted selection for breeding new rice varieties with high resistance starch, Journal of Nuclear Agricultural Sciences, 2015, 29(12): 2259-2267 ).

[0067] Therefore, the T0 generation plants obtained in Example 1 are planted in individual plants, and the leaves of the individual plants are preserved for subsequent extraction of DNA, and the seeds are correspondingly harvested. By observing the chalkiness of T1 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an artificial site-directed mutant of a paddy rice starch branching enzyme SBE3 gene and applications thereof. The artificial site-directed mutant is obtained by modifying the 8th exon OF SBE3 gene by a CRISPR / Cas9 gene targeting and editing technology so as to delete the base of the 8th exon. The 8th exon OF SBE3 gene is subjected to artificial mutation by adopting a CRISPR / Cas9 technology; paddy rice plants with prominently increased resistant starch content are picked out, the screening mark of mutant is removed through segregation posterity; and the content of resistant starch can reach 10% or more.

Description

technical field [0001] The invention relates to the field of rice genome editing and breeding, in particular, the invention relates to an artificial site-directed mutant of rice starch branching enzyme SBE3 gene and its application. Background technique [0002] Resistant starch (Resistant Starch, referred to as RS) refers to "starch or starch degradation products that cannot be absorbed in the small intestine of healthy individuals" (defined by EURESTA, the European RS Association). Previous studies have shown that resistant starch cannot be digested and absorbed and provide glucose in the small intestine, but can be fermented by physiological bacteria in the large intestine to produce short-chain fatty acids (SCFA) and gas. Resistant starch has important physiological functions, including reducing postprandial blood sugar and insulin response, improving the body's sensitivity to insulin, preventing constipation and colon cancer, reducing serum cholesterol and triglyceride ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/54C12N15/82C12N5/10A01H5/00C12N9/22
CPCC12N9/107C12N9/22C12N15/8213C12N15/8245C12Y204/01018
Inventor杨瑞芳朴钟泽白建江方军
OwnerSHANGHAI ACAD OF AGRI SCI