Primer pair, kit, detection method and application for detecting egfr gene mutation

A primer pair, to-be-detected technology, used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problem of high cost and achieve the effect of high sensitivity and simple operation

Active Publication Date: 2021-03-23
ZHEJIANG UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the methods for gene mutation detection of cfDNA mainly include digital PCR and next-generation sequencing (NGS). too high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair, kit, detection method and application for detecting egfr gene mutation
  • Primer pair, kit, detection method and application for detecting egfr gene mutation
  • Primer pair, kit, detection method and application for detecting egfr gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] According to the EGFR gene sequence (transcription number ENST00000275493.6, the data comes from the ensemble database) and the three mutations of S492R, G465E, and G465R, primers for detecting each mutation point were designed respectively, and provided by Sangon Bioengineering (Shanghai) Co., Ltd. synthesis.

[0037] (1) The primers for detecting the S492R mutation of the EGFR gene are:

[0038] Upstream primer: AACTGGAAAAAACTGTTTGGGAC (SEQ ID NO.1),

[0039] Downstream primer: GCTGTTTTCACCCTCTGTTGAG (SEQ ID NO. 2).

[0040] The amplified fragment sequence is:

[0041] AACTGGAAAAAACTGTTTGGGACCTCCGGTCAGAAAACCAAAATTATA CT CAACAGAGGTGAAAACAGC (SEQ ID NO. 6), the fragment size is 69bp.

[0042] (2) The primers for detecting the G465E mutation of the EGFR gene are:

[0043] Upstream primer: GTGATGGAGATGTGATAATTTCATA (SEQ ID NO.3),

[0044] Downstream primer: CTGTTGCTTATAATTTTGGTTTTCTGAC (SEQ ID NO. 4).

[0045] The amplified fragment sequence is:

[0046] GTGATGGA...

Embodiment 2

[0053] Standard plasmid construction.

[0054] (1) Plasmid containing the wild-type EGFR gene sequence: the full-length EGFR gene sequence was synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., in which the extracellular region of the EGFR gene (EGFR ECD, 330bp to 2192bp of the full-length EGFR gene) The sequence was constructed into pMD19-T vector, named pMD19-T-EGFR.

[0055] (2) A plasmid containing the S492R mutation of the EGFR gene: using the above pMD19-T-EGFR plasmid as a template, introduce the S492R point mutation by point mutation PCR, and the point mutation primers are as follows:

[0056] Upstream primer: CGGTCAGAAAACCAAAATTATA C GCAACAGAGGTGAAAACAGCT (SEQ ID NO. 9),

[0057] Downstream primer: AGCTGTTTTCACCTCTGTTGCGTATAATTTTGGTTTTCTGACCG (SEQ ID NO. 10).

[0058] The result of the point mutation was verified by sequencing of Sangon Bioengineering (Shanghai) Co., Ltd., and the resulting plasmid was named pMD19-T-EGFR-S492R.

[0059] (3) A plasmid conta...

Embodiment 3

[0068] Take pMD19-T-EGFR plasmid and pMD19-T-EGFR-S492R plasmid, use ddH 2 O dilution, the mutant plasmid and the wild type plasmid were mixed in proportion to the copy number, and the templates of mutant / (wild type+mutant) were respectively 0, 0.001, 0.005, 0.01, 0.03, 0.05, 0.1, 1 were prepared. 5 x 10 of the plasmid standard 5 Copy number DNA was used as a reference sample.

[0069] Take pMD19-T-EGFR plasmid and pMD19-T-EGFR-G465E plasmid, use ddH 2 O dilution, the mutant plasmid and the wild-type plasmid are mixed according to the copy number ratio, and the templates of mutant / (wild-type+mutant) are respectively 0, 0.001, 0.01, 0.05, 0.1, 1, and the plasmid standard 1.6×10 5 Copy number DNA was used as a reference sample.

[0070] Take pMD19-T-EGFR plasmid and pMD19-T-EGFR-G465R plasmid, use ddH 2 O dilution, the mutant plasmid and the wild type plasmid were mixed in proportion according to the copy number, and the templates of the mutant type / (wild type+mutant type) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer pair for detecting EGFR gene mutation, as well as a kit, a detection method and applications. The three primer pairs are used for detecting S492R mutation, G465E mutation and G465R mutation of EGFR gene, respectively. The method adopts ARMS PCR principle, Taq DNA polymerase lacks of 3'-5'exonuclease activity, and the sharp reduction of products can be caused by mismatching of 3' terminal of the PCR primer; by designing a specific primer, the amplification is blocked by a wild type template, so that the purpose of detecting mutant type can be achieved. The tolerance mutation of EGFR gene can be detected by the primer pair through a fluorescent quantitative PCR method, the operations are simple, accurate results can be obtained only through liquid biopsy, the sensitivity is high, and even 1% mutation can be detected.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a pair of primers, a kit, a detection method and an application for detecting EGFR gene mutation. Background technique [0002] EGFR protein is a transmembrane tyrosine kinase receptor, a member of the protein kinase superfamily (ERBB1), which consists of an extracellular ligand-binding domain, a transmembrane region, and an intracellular tyrosine kinase domain. The activation of receptors plays an important role in the signal transmission of tumor cell proliferation and growth. Overexpression of the EGFR gene or mutations in its ectodomain and kinase domain are associated with the development of many tumors, including non-small cell lung cancer (NSCLC), colorectal cancer (CRC), head and neck squamous cell carcinoma (HNSCC) and pancreatic cancer. cancer. Protein kinase inhibitors (TKIs) such as gefitinib, erlotinib, lapatinib and other small molecule targeted drugs...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6886C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q1/6886C12Q2600/106C12Q2600/118C12Q2600/156C12Q2531/113C12Q2563/107
Inventor吴姗姗来骏周婕周展陈枢青
OwnerZHEJIANG UNIV