Specific primer for detecting Salmonella pullorum, kit containing the primer and application thereof
A detection kit and Salmonella technology are applied in the field of biotechnology detection to achieve the effects of accurate results, simple operation and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1: Primer design
[0053] A comprehensive bioinformatics analysis of the entire genome of pullorum, typhoid fever and Salmonella enteritidis serotypes in GenBank was performed, and the SEEP17695 gene (shown in SEQ ID NO. 1) was finally determined as the detection target gene of Salmonella pullorum.
[0054] According to the SEEP17695 gene, Oligo 6 software was used to design specific primers, and the primers were synthesized by Suzhou Jinweizhi Company. The primer sequence is as follows:
[0055] SEEP17695-idF10: 5'TCTAGCACTGAACTTGGCGA 3'(shown in SEQ ID NO. 2);
[0056] SEEP17695-idR10: 5'TGTGTCGCCATTGTAGGTCA 3'(shown in SEQ ID NO. 3).
Embodiment 2
[0057] Example 2: Establishment of PCR detection method for Salmonella pullorum
[0058] 1. Experimental strains and reagents
[0059] The experimental strains are shown in Table 1, among which 13 strains were isolated and identified by the Animal Bacterial Disease Laboratory of Harbin Veterinary Research Institute.
[0060] Premix Ex Taq DNA polymerase and Marker DL2000 were purchased from TaKaRa Company.
[0061] Table 1 Experimental strains
[0062]
[0063]
[0064] Note: ①: China Veterinary Microbial Culture Collection Management Center; ②: China Medical Bacteria Collection Management Center; ③: China Industrial Microbial Culture Collection Management Center; ④: American Type Culture Collection; ⑤: Tiangen Biochemical Technology (Beijing ) Limited company; ⑥: Keep in this room.
[0065] 2. Method
[0066] 2.1 Selection of the most suitable bacteria enrichment solution and template preparation method
[0067] Five different enrichment solutions were used to amplify and culture Salmone...
Embodiment 3
[0097] Example 3: Detection of artificially contaminated samples
[0098] In the actual detection process, both chicken manure and chicken meat may be the objects to be detected. The present invention selects these two samples, artificially contaminates them with Salmonella pullorum, and tests the obtained artificially simulated pollution samples.
[0099] 1. Detection of artificially contaminated chicken manure samples
[0100] The feces of SPF chickens in an SPF-level breeding environment were aseptically collected, and 10 g of feces were added to 90 mL of SC enrichment solution and cultured overnight. Dilute the overnight culture of Salmonella pullorum with sterile water 10 times the ratio, inoculate the appropriate dilution of the bacteria solution into the chicken manure mixture (10g feces + 90mL SC enrichment solution), and use the colony counting method to obtain the chicken The concentration of Salmonella pullorum, and then calculate the inoculation amount of Salmonella pull...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap