Supercharge Your Innovation With Domain-Expert AI Agents!

Oryza sativa floury endosperm related gene OscyMDH, protein encoded by same and application

A protein and gene technology, applied in the field of genetic engineering, can solve problems such as unclear regulation mechanism of rice starch

Active Publication Date: 2017-12-15
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, some rice flour quality genes have been finely mapped and cloned, but the regulatory mechanism of rice starch synthesis is still unclear, which requires us to map and clone more starch synthesis genes to further reveal the mechanism of rice starch synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oryza sativa floury endosperm related gene OscyMDH, protein encoded by same and application
  • Oryza sativa floury endosperm related gene OscyMDH, protein encoded by same and application
  • Oryza sativa floury endosperm related gene OscyMDH, protein encoded by same and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1. Discovery of Rice Starch Synthesis Related Sites and Their Encoding Genes

[0041] 1. Starch content distribution analysis and genetic analysis of rice endosperm flour mutant N65

[0042] Among the N22 mutants produced by MNU chemical mutagenesis, an endosperm powdery mutant was screened and named N65.

[0043] Compared with N22, the main feature of N65 is: the starch content in the seeds decreases (see figure 1 ), with an opaque seed phenotype (see figure 2 ). Panel A shows that N22 has translucent endosperm and panel B shows that N65 endosperm is opaque. This indicated that the gene mutation affected the synthesis of starch, resulting in changes in the structure and properties of starch granules, which made the appearance of endosperm significantly different.

[0044] The cross-sections of wild-type and mutant N65 seeds were observed by scanning electron microscopy (see image 3 ), from the magnified 200-fold photo, the starch sheet structure of the cro...

Embodiment 2

[0078] Embodiment 2, the acquisition and identification of transgenic plants

[0079] 1. Construction of recombinant expression vector

[0080] Using the genomic DNA of N22 (from the rice germplasm resource bank of Nanjing Agricultural University) as a template, the OscyMDH gene was obtained by PCR amplification. The PCR primer sequences are as follows:

[0081] primer3:

[0082] 5'CCGGCGCGCCAAGCTTAAGTAATTTGGGAAAGAGG 3' (SEQ ID NO. 6);

[0083] primer4:

[0084] 5'GAATTCCCGGGGATCCTTAGTTGAGGCATGAGTAAG 3' (SEQ ID NO. 7).

[0085] The above primers are located at the upstream 2kb and downstream 1.5kb of the gene shown in SEQ ID NO.2, the amplified product contains the promoter part of the gene, and the PCR product is recovered and purified. The PCR product was cloned into the vector pCAMBIA1390 using the INFUSION recombination kit (Takara, Japan). INFUSION recombination reaction system (10 μL): PCR product 1.0 μL, pCAMBIA1305 6.0 μL, 5×infusion buffer 2.0 μL, infusion enzyme...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an oryza sativa floury endosperm related gene OscyMDH, a protein encoded by the same and an application. The gene OscyMDH refers to DNA molecules shown as the following 1), 2), 3) or 4): 1) DNA molecules shown as SEQ ID NO.1; 2) DNA molecules shown as SEQ ID NO.2; 3) DNA molecules hybridized with DNA sequences limited in 1) or 2) under stringent conditions and encoding the protein; 4) DNA molecules having 90% or higher homology with DNA sequences limited in 1), 2) or 3) and encoding plant starch synthesis related protein. The invention further provides the protein encoded by the gene. The protein affects synthesis of starch in plant endosperm, and transgenic plants with normal starch synthesis can be cultured by transferring the protein encoding gene into plants with abnormal starch synthesis. The protein and the protein encoding gene can be applied to genetic improvement of the plants.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a rice endosperm flour quality-related gene OscyMDH and its encoded protein and application. Background technique [0002] Rice is an important food crop and one of the model plants for plant research. Rice seeds accumulate a large amount of starch during the maturation process, which provides the main energy for seed germination and seedling growth and development. At the same time, these considerable amounts of starch also become an important food source for humans. The amount of starch accumulated in rice seeds often determines the size and weight of the seeds, which is directly related to the yield of rice. At the same time, the ratio of amylose and amylopectin in the seeds directly affects the eating quality of rice. Therefore, the study of starch synthesis in rice The process has important application value, and in-depth research on its development and geneti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N9/04C12N15/82A01H5/00
CPCC12N9/0006C12N15/8245C12Y101/01037
Inventor 万建民王益华滕烜江玲刘喜刘世家田云录陈亮明张文伟刘裕强赵志刚
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More