Preparation method of duck Tembusu reporter virus carrying Renilla luciferase and its products and applications
A technology of renilla luciferase and reporter virus, which is applied in the field of construction of Duck Tembusu reporter virus, can solve the problem of successful construction of no DTMUV virus, and achieve excellent sensitivity and convenient use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] (1) Synthesize the sequence of 5'CS comprising FMDV 2A and synonymous mutation:
[0035] In order to insert the sequence containing FMDV 2A and synonymously mutated 5'CS into the P1 fragment and synonymously mutate the original 5'CS sequence, multiple rounds of fusion PCR amplification were required. In order to reduce the difficulty of fusion PCR, the sequence containing FMDV 2A and synonymous mutation 5'CS was directly sent to the whole gene synthesis, referred to as C26-RLuc-FMDV 2A, the specific sequence is as follows:
[0036] cgttgagcgagttctcaaaaatgaacaacagctgttgaattttgaccttctcaagctggcgggagacgtcgagtccaaccctgggccaatgtctaacaaaaaaccaggaagacccggctcaggccgggttgtgaacatgttgaagcgcggaacgtcccgcggaaatccgctagcgcggataaagaggacgattgatggggtcctgagaggagcaggacccataaggtttgtgctggctctactgactttcttcaagtttacagccctgaggc(SEQ ID NO.1)。
[0037] (2) Amplify Renilla luciferase expression cassette
[0038] The pRL-TK plasmid was used as a template, and RLuc-F and RLuc-R were used as primers for...
Embodiment 2
[0055] Pick a single colony of the correctly sequenced reporter virus plasmid, shake at 120rpm / min at 30°C until the turbidity is appropriate. Use the endotoxin-free plasmid extraction kit to extract the plasmid for later use.
[0056] Using mMESSAGE mMACHINE TM T7Transcription Kit performs in vitro transcription, strictly following the supplier’s recommended procedures, using RNase-free pipette tips and EP tubes, etc.:
[0057] (1) In order to prevent the transcription of an excessively long chain, 10 μg of pACYC RLuc-TMUV plasmid was fully linearized by NotI single enzyme digestion to terminate transcription;
[0058] (2) Preparation of in vitro transcription system:
[0059]
[0060] Then incubate at 37°C for 3h;
[0061] (3) After the transcription is completed, add 1 μl TuRBO DNase, mix well, and incubate at 37°C for 15 minutes;
[0062] (4) Lithium chloride precipitation to recover RNA:
[0063] a) Add 30μl Nuclease-free ddH 2 O and 30 μl LiCl precipitation sol...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap