Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Jerusalem artichoke fructan exo-hydrolase gene 1-FEH III and protein encoded by same and application

A technology of 1-FEHIII and fructan, applied in the fields of hydrolase, application, genetic engineering, etc.

Active Publication Date: 2018-01-16
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Few fructan exohydrolases have high hydrolysis ability to sucrose in current research reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Jerusalem artichoke fructan exo-hydrolase gene 1-FEH III and protein encoded by same and application
  • Jerusalem artichoke fructan exo-hydrolase gene 1-FEH III and protein encoded by same and application
  • Jerusalem artichoke fructan exo-hydrolase gene 1-FEH III and protein encoded by same and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Cloning of embodiment 1 Jerusalem artichoke Ht1-FEH III

[0029] With upstream primer primer ATGATGAAGATTTATGGGTTTTG (SEQ ID NO.3) and downstream primer TTATATAATAGGCTTTCTTC (SEQ ID NO.4) and Jerusalem artichoke tuber cDNA (mRNA reverse transcription) as template and common Taq enzyme (CW Kangwei Company) for PCR amplification , the reaction system is as follows:

[0030]

[0031] The amplified product was run on the gel and photographed on the gel, and the band of the corresponding size was cut out for recovery. After connecting with the carrier PMd-19, it was transferred to Escherichia coli and sent for sequencing. After the sequencing was correct, the plasmid was extracted with a plasmid extraction kit (CW Kangwei Co., Ltd.). All operating steps refer to Instructions are carried out.

[0032] According to the prediction of the Jerusalem artichoke database, the size of the spliced ​​Ht1-FEH III gene is 1719bp. Using cDNA as a template and using specific primers f...

Embodiment 2

[0035] 2.1 Construction of expression vector

[0036] Using pPiczαC as a vector, because it has a 6xHIS tag, it can be expressed in Pichia pastoris and attached with affinity Ni in the purification stage + column to achieve the purpose of purification. Ht1-FEH III was amplified by high-fidelity enzyme (TaKaRa), and PCR amplification was performed with the above cloned Ht1-FEH III, and restriction sites XhoI / NotI were added to both ends of the gene ( image 3 Left picture), connect the pEASY-Blunt (TransGen) vector for transformation, select positive clones for sequencing, and extract the plasmid for double enzyme digestion after the sequencing is correct ( image 3 Right picture), in order to connect the target gene to the pPiczαC vector, pPiczαC was also digested with XhoI / NotI double enzymes, after digestion, it was ligated with T4 ligase (TaKaRa, D2011A), and after transfection into E. coli, it was placed on a low-salt LB plate containing Zeocin Positives in the screening...

Embodiment 3

[0043] Purification and SDS-PAGE of embodiment 3 recombinant protein

[0044] 3.1 Protein purification

[0045] After 5 days of induction, use a 4°C refrigerated centrifuge to remove the bacterial cell pellet and take the supernatant to obtain a crude enzyme solution, which is stored at -80°C. The purification process starts with 80% ammonium sulfate precipitation, 100ml of crude enzyme solution needs to be salted out by adding 51.6g of ammonium sulfate; pour 100ml of crude enzyme solution into a beaker placed on ice, and slowly stir while adding ammonium sulfate solid until Dissolve it completely, then put it in the refrigerator for salting out overnight, take it out and centrifuge the next day, and the protein precipitate obtained by centrifugation also needs to be washed twice with 80% ammonium sulfate solution and then centrifuged, and finally dissolved in 50mM acetic acid sodium acetate buffer solution with pH5.2 middle.

[0046] In order to further remove salt ions, th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Protein molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a jerusalem artichoke fructan exo-hydrolase gene 1-FEH III and protein encoded by the same and application. The jerusalem artichoke fructan exo-hydrolase gene 1-FEH III is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1. The nucleotide sequence of jerusalem artichoke fructan exo-hydrolase encoded by the jerusalem artichoke fructan exo-hydrolase gene 1-FEH III is shown as SEQ ID NO. 2. According to the invention, a new fructan exo-hydrolase gene 1-FEH III is cloned from the jerusalem artichoke, the jerusalem artichoke fructan exo-hydrolase encodedby the new erusalem artichoke fructan exo-hydrolase gene 1-FEH III is different from the reported fructan exo-hydrolase with no hydrolysis ability on sucrose or with weak hydrolysis ability on sucrose, and has a hydrolysis ability on sucrose. At the same time, Ht1-FEH III also has a weaker ability to hydrolyze levan-type fructan, namely, the ability to hydrolyze beta(2,6) bonds. Obviously, Ht1-FEHIII is not an ordinary FEH but may be a new type fructan exo-hydrolase.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a Jerusalem artichoke fructan exohydrolase gene 1-FEH III and its encoded protein and application. Background technique [0002] Fructan exohydrolase (FEHs) participates in the hydrolysis of fructan in plants, which not only provides the nutrients needed for plant growth, but also protects plants from stress under adverse conditions. In recent years, FEHs in plants have been discovered one after another, and the cDNAs sequences of 1-FEHs (which can hydrolyze β(2,1)-linked fructans) were successively cloned from chicory, perennial ryegrass and brome awnless leaves (Van den Ende et al. 2000) (Lothier et al. 2007; Del Viso et al. 2009). The cDNAs of 6-FEHs (which can hydrolyze β(2,6)-linked fructans) were screened and cloned in timoss (Tamura et al. 2011, wheat (Van Riet et al. 2006). The other two types 6&1-FEHs (Kawakami et al.2005) and 6-KEHs (Van den Ende et al.2005) have also been ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/56C12N9/24C12N15/81C12R1/84
Inventor 梁明祥詹文悦张茜
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com