Plasmid pZF17-30 for constructing Brucella mutant strain, construction method of plasmid and application of plasmid

A construction method and plasmid technology, applied in the field of genetic engineering, can solve problems such as time-consuming, low probability, and inability to withstand DNA, and achieve the effects of large screening workload, low recombination rate, and simple design.

Inactive Publication Date: 2018-01-23
HUAZHONG AGRI UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are many difficulties in the functional study of Brucella genes
One is that Brucella grows slowly. In a stable culture environment in the laboratory, the bacteria need to grow for 36-48 hours to grow visible colonies on the plate. The wild strains isolated for the first time tend to grow more slowly.
The second is the zoonotic characteristics of Brucella patients, which makes the operation of Brucella quite cumbersome and time-consuming
These gene deletion mutants have improved the shortcomings of traditional attenuated brucellosis vaccines, such as poor safety and interference with serological immune diagnosis.
However, most of the current technologies for constructing the deletion of virulence genes in Brucella use traditional homologous recombination combined with suicide plasmids, but traditional homologous recombination technology has its own drawbacks, for example, it is necessary to rebuild complex targeting for different target genes And screening of vector plasmids makes the operation cumbersome, heavy workload, time-consuming, and increases the cost of experiments. At the same time, the construction of vector plasmids is also limited by the restriction enzyme sites on the genome where the cloning vector and target gene are located. Functional genomics During the experimental operation, the cloning vector may not be able to withstand large fragments of DNA. In addition, the traditional homologous recombination technology has a low probability of recombination (Copeland et al 2001), which limits the large-scale application of this technology in the laboratory, and also makes Bruce Progress in research on bacterial virulence genes is slow, so this traditional Brucella gene editing technology is expected to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plasmid pZF17-30 for constructing Brucella mutant strain, construction method of plasmid and application of plasmid
  • Plasmid pZF17-30 for constructing Brucella mutant strain, construction method of plasmid and application of plasmid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Construction of pZF17-30 plasmid

[0029] The composition of the pZF17-30 plasmid is as follows figure 1 As shown, the build process is as follows figure 2 As mentioned, the specific method is as follows:

[0030]1. Insert the sgRNA into the plasmid pBBR1-MCS-5, the sequence of the sgRNA is 5′-GTTTTAGAGCTAGGCCAACATGAGGATCACCCATGTCTGCAGGGCCTAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGGCCAACATGAGGATCACCCATGTCTGCAGGGCCAAGTGGCACCGAGTCGGTGCTTTTT-3′, transform Escherichia coli-TransT1 competent cells, obtain 2pZF1

[0031] 2. Using the plasmid pCMV-BE3 as a template, oWY-158 (5'-AAGGAAGCTAAAATGCATATGAGCTCAGAGACTGGCCCAG-3') and oWY-159 (5'-TGGAGATCCTTACTCGAGAGGCTGATCAGCGGGTTTAAAC-3') as primers to amplify the rAPOBEC1-nCas9-ugi fragment (5182bp); Using pZF17-26 as template, oWY-156 (5′-CTCGAGTAAGGATCTCCAGG CATCA-3′), oWY-157 (5′-ATGCATTTTAGCTTCCTTAGCTCCT-3′) as primers, amplify the linearized vector (pBBR1oriV- lac I) (9119bp); the above-mentioned amplified linearized ve...

Embodiment 2

[0034] Application of embodiment 2 plasmid pZF17-30 in the preparation of Brucella mutant strain

[0035] In this embodiment, pZF17-30 is used as a starting plasmid to construct a mutant strain of Brucella, and the 478th base C of the CDS region sequence of the Brucella VirB10 gene is directionally mutated to T, and the CDS region sequence of the Brucella virB10 gene As shown in SEQ ID NO.2. The specific method is as follows:

[0036] 1. Design specific sgRNA, the specific sequence is as follows: oWY-181 (5'-TGGA -3'), oWY-182 (5'-CAAAGCTTGGTGTTCTTTTGACTGT-3'), bold indicates the homologous sequence of sgRNA and target gene, underlined is the stop codon to be mutated.

[0037] 2. Preparation of linearized plasmid vector: Use the restriction endonuclease Bsa I to digest the plasmid pZF17-30 to make it linearized, use it as a carrier after purification with the Magnetic Bead Micro DNA Gel Recovery Kit (TAKARA), and digest The system is as follows:

[0038] pZF17-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a plasmid pZF17-30 for constructing a Brucella mutant strain, a construction method of the plasmid and an application of the plasmid. The construction process mainly includes the steps: amplifying an rAPOBEC1-nCas9-UGI fragment from a commercial plasmid pCMV-BE3; integrating the fragment with a carrier containing a general host replicon pBBR1-MCS-5 and non-specific sgRNA byrecombination reaction; inserting a ccdB gene and a Chl resistance gene into the sgRNA; digesting the plasmid pZF17-30 by the aid of restricted enzyme BsaI; connecting specific sgRNA with linearized pZF17-30. The sequence of the constructed carrier is as shown in SEQ ID NO. 3, the carrier can be used for constructing the Brucella mutant strain, and a 478-site basic group in a CDS (coding sequence)area of a virB10 gene is mutated into T from C.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a plasmid pZF17-30 for constructing a Brucella mutant strain and a construction method thereof, which can be used for terminating mutation of the brucella gene coding region, and premature termination of protein translation. Background technique [0002] Brucellosis (brucellosis) is an important zoonotic disease that has spread to the world and has caused serious economic losses to the animal husbandry. a major threat. However, so far, no safe and effective vaccine has been developed. Brucella, also known as Brucella, is the pathogen that causes brucellosis. To develop safe and effective vaccines, it is very important to study the functions of various genes of the bacteria. [0003] At present, there are many difficulties in the functional research of Brucella genes. The first is that Brucella grows slowly. Under a stable culture environment in the labo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/74C12N1/21C12R1/19
Inventor刘正飞郑可汪洋李娜
OwnerHUAZHONG AGRI UNIV