Myeloma BCMA antigen-targeted transgenic T cell, and preparation method and application thereof

A transgenic and myeloma technology, applied in the direction of targeting specific cell fusion, receptors/cell surface antigens/cell surface determinants, genetically modified cells, etc., can solve the problem of carT cell loss, lack, and treatment efficiency in patients low level problem

Inactive Publication Date: 2018-03-23
YINFENG BIOLOGICAL GRP +1
View PDF3 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] 2. The effective rate of treatment is lower than the 70-90% complete cure rate of typical CD19 carT. The effective rate needs to be improved and the inhibition of the tumor microenvironment needs to be overcome;
[0012] 3. After successful treatment, the patient’s body lacks antibody-producing plasma cells for a long time, so immunoglobulin must be injected every 2 to 3 weeks to maintain basic immune requirements;
[0013] 4. During the course of treatment, some patients lose carT cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Myeloma BCMA antigen-targeted transgenic T cell, and preparation method and application thereof
  • Myeloma BCMA antigen-targeted transgenic T cell, and preparation method and application thereof
  • Myeloma BCMA antigen-targeted transgenic T cell, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Construction of lentiviral vector

[0038] Schematic diagram of lentiviral vector construction figure 1 shown.

[0039] The design of car molecules and auxiliary screening markers such as figure 2 shown.

[0040] The nucleotide sequence of the constructed car molecule is shown in SEQ ID NO:2.

[0041] Lentiviral coating: a conventional method. Briefly, 293T cells were cultured with RPMI1640+10% FBS. After the cells reached 90% density, the plasmids were mixed and transfected with lipo2000, and the 293T cells were transfected. After the lentiviruses were harvested, they were centrifuged and concentrated. The method of plasmid transfection into 293T cells was in accordance with the reagent guide of lipofactamine 2000 of Invitrogen manufacturer. Plasmids include: lentiviral expression plasmid, 3 kinds of helper plasmids (pMDLg / pRRE, pRSV-Rev, pMD2.G), the molar ratio of mixed plasmids is 2:1:1:0.5. After 24-48 hours of transfection, harvest the supernatant...

Embodiment 2

[0042] Example 2 Culture and lentiviral transfection of T cells

[0043] 50-100 ml of peripheral blood was drawn from healthy people or tumor patients, or mononuclear cells were obtained with a Cobra Spectra blood cell separator, separated by Ficoll, and sorted with CD4+ or CD8+ magnetic beads (the magnetic beads were purchased from Stem Cell Technologies). After T cells were cultured for 1 day (medium formula: Lonza X vivo15, adult serum 10%, IL2300-500IU / ml, penicillin (100units / ml) and streptomycin (100μg / ml), anti-CD3CD28 magnetic beads (with T cell 1:3 mixture) after culturing for 24 hours, they were infected with lentivirus.

[0044] Infection of human CD4+T or CD8+T cells with lentivirus: Refer to the instructions of Takara Retronectin for the prepared and concentrated lentivirus infection, which is briefly described as follows:

[0045] Prepare Retronectin at a concentration of 20-100 μg / ml, and use a density of 4-20 μg / cm for plating 2 After 2 hours at room temperat...

Embodiment 3

[0047] Example 3 Knockout of PD1 gene and CTLA4 gene

[0048] Electrotransfection of CRISPR-cas9 for gene editing of T cells, and experiments for knocking out the PD1 gene and CTLA4 gene respectively, the specific methods are as follows:

[0049] CRISPR-cas9 mRNA and gRNA synthesized in vitro were mixed with HDR, and electroporated into T cells (400V, 0.5ms). Genomic DNA was harvested after the cells were cultured in Lonza X vivo15, adult serum 10%, IL2300-500IU / ml for 3 days. Then do genomic PCR (primers targeting the region near exon2 of PD1, Forward: TTCCTCACCTCTCTCCATCTC; Reverse: CTCTCTTTGATCTGCGCCTT, as shown in SEQ ID NO: 8, SEQ ID NO: 9. Primers targeting the region near exon2 of CTLA4: Forward: TGAGTTCACTGAGTTCCCTTTG; Reverse: GAAATGGCTTTGCTCACCAATTA, as shown in SEQ ID NO: 10, SEQ ID NO: 11), after Agarose gel purification, TA cloning, purification of a single clone and sequencing to obtain Indel mutation information, and calculate the information of the mutated and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene for encoding anti-BCMA chimeric antigen receptor. The nucleotide sequence of the gene is represented by SEQ ID NO:2. The invention also discloses a recombinant expression vector containing the gene, and a myeloma BCMA antigen-targeted transgenic T cell. The transgenic T-cell is a primitive cell containing the recombinant expression vector and knocked out of a PD1 gene or / and a CTLA4 gene, or is a primitive cell with the chromosome being integrated with the gene for encoding anti-BCMA chimeric antigen receptor and knocked out of tbe PD1 gene or / and the CTLA4 gene.A preparation method of the transgenic T-cell comprises the following steps: mixing of gRNA, CRISPR-cas9 mRNA and HDR mix, and electrotransformation recombination of the T cell. The invention furtherdiscloses an application of the myeloma BCMA antigen-targeted transgenic T cell in the preparation of drugs for treating multiple myeloma. In the construction process of carT of, a recognition sequence of EGFR is introduced, EGFR monoclonal antibody Cetuximab is used to eliminate a carT cell if necessary, and PD1 and CTLA4 genes are knocked out to relieve the inhibition effect of the PD1 and CTLA4 genes on the carT cell and enhance the overcoming effect of the carT cell on the inhibition of the tumor microenvironment on immune cell functions.

Description

technical field [0001] The invention relates to a transgenic T cell targeting myeloma BCMA antigen, a preparation method and application thereof. Background technique [0002] Multiple myeloma is a blood cancer that begins in the bone marrow, usually when infection-fighting plasma cells in the bone marrow become cancerous and multiply uncontrollably. Multiple myeloma can lead to weakened immunity and many other problems, including bone and kidney problems. There are approximately 114,200 new cases of multiple myeloma worldwide each year and more than 79,000 deaths from the disease each year. The incidence rate of multiple myeloma in my country is about 1 / 100,000 to 2 / 100,000, and the incidence rate in European and American countries is 4 / 100,000. [0003] The treatment of multiple myeloma has gone through the traditional chemotherapy period, the hematopoietic stem cell transplantation period, and the current new drug period represented by thalidomide, lenalidomide and bort...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N9/22C12N15/90C12N5/10A61K35/17A61P35/00
CPCA61K35/17C07K14/7051C07K16/2878C07K2317/622C07K2319/00C07K2319/02C07K2319/03C07K2319/33C12N5/0636C12N9/22C12N15/86C12N15/907C12N2510/00C12N2740/15043Y02A50/30
Inventor黄昕华于丽丽生德伟徐峰波李德柱曹启龙
OwnerYINFENG BIOLOGICAL GRP