Production method of cellular structure tension change-based skin-color-changeable fluorescent fish
A cell structure and color-changing technology, applied in the field of fluorescent fish, can solve the problem of inability to realize multi-color fluorescent expression, and achieve the effect of increasing the interaction between mermaids, expanding the pattern, and improving the fun.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Example 1: Construction of fluorescent fish with variable skin color using eCFP and eYFP as selected protein pairs
[0087] Step 1: Amplification and acquisition of the target fragment
[0088] The selected two fluorescent proteins, eCFP and eYFP, and microfilament skeleton protein β-actin were subjected to PCR amplification (52°C, 30 cycles), and the primers were as follows:
[0089] Enhanced cyan fluorescent protein (eCFP) length 717bp
[0090] Upstream primer: pATGGTGAGCAAGGGCGAGGA
[0091] Downstream primer: pCTTGTACAGCTCGTCCATGC
[0092] Enhanced orange fluorescent protein (eYFP) length 717bp
[0093] Upstream primer: pATGGTTTCTAAAGGTGAAGA
[0094] Downstream primer: pTTTATATAATTCATCCATAC.
[0095] Actin skeleton protein (β-actin) length 1125bp
[0096] Upstream primer: ATGGATGATGATATCGCCGC
[0097] Downstream primer: CTAGAAGCATTTGCGGTGGACGA
[0098] After electrophoresis and recovery of the PCR product, 10% loading buffer was added to mix well, and then ad...
Embodiment 2
[0149] Example 2 Using fish species with more pigmentation on the body surface as materials to construct fluorescent fish with variable skin color
[0150] In this embodiment, the knockout of the zebrafish golden gene will be taken as an example for illustration.
[0151] Step 1: Construct the gRNA vector of the target sequence
[0152] Firstly, the genome sequence of the golden gene of zebrafish was found on the website of NCBI (National Center for Biotechnology Information, USA). Find the exon region and lock the target sequence as GTGCAGGAGAGGAAAGATGG.
[0153] Then, to construct the target sequence gRNA, synthesize the following primers:
[0154] gRNA-F: CACCGTGCAGGAGAGGAAAGATGG
[0155] gRNA-R: ATACCCATCTTTTCCTCTCCTGCAC
[0156] Equal volumes of primers gRNA-F and gRNA-R with a final concentration of 10 nM were mixed together (25 μL each, 50 μL total volume). On a PCR machine, perform annealing. The procedure is as follows: 98°C for 5 minutes, then naturally cool to...
Embodiment 3
[0208] Embodiment 3: culture from fertilized egg to adult fish
[0209] In this embodiment, a koi carp will be taken as an example for illustration.
[0210] Step 1: Introducing the plasmid into the fertilized egg
[0211] (1) Prepare experimental fish and injection equipment
[0212] The koi used for egg collection were taken from sexually mature broodstock in the Songpu Experimental Field of Heilongjiang Fisheries Research Institute. The microinjector is the Nissan M-4A / B type, and the glass needle is drawn into a fine tip with an aperture of 2-10 P'm with a Nissan free-fall needle puller (PP-83).
[0213] (2) Specific operation
[0214] During the carp breeding season in mid-May every year, select mature broodstock to induce spawning artificially or capture broodstock with eggs flowing in the broodstock pond, collect high-quality eggs and semen, and store them in the refrigerator (6-8°C) for later use. Take a small amount of sperm and eggs for mixed insemination, and ma...
PUM
Property | Measurement | Unit |
---|---|---|
Outer diameter | aaaaa | aaaaa |
The inside diameter of | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com