Application of gene and construction method of animal model

A technology of animal model and construction method, applied in the construction of animal model, application field of gene

Active Publication Date: 2018-04-20
NORTHEAST NORMAL UNIVERSITY
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the expression of oxytocin receptor in mammary gland

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gene and construction method of animal model
  • Application of gene and construction method of animal model
  • Application of gene and construction method of animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Construction of embodiment 1 overexpression vector

[0056] 1. The β-actin promoter was amplified by PCR

[0057] Using the plasmid as a template, the β-actin promoter was amplified by PCR, as follows:

[0058] (1) PCR primer sequence:

[0059]

[0060] (2) Reaction system

[0061]

[0062] (3) PCR amplification conditions:

[0063] 98℃2min

[0064]

[0065] Store at 4°C

[0066] 2. Perform gel recovery on the amplified PCR product.

[0067] 3. Digest the vector frame pVector and the β-actin promoter amplified in step 2 with restriction endonucleases HindII and ApoI, and recover 3kb and 1.7kb fragments from the gel.

[0068] 4. Connection

[0069] Reaction system (25μl): (Reagents from TAKARA)

[0070] T4 DNA Ligation buffer

2.5μl

β-actin fragment

1μl (75ng)

pVector

1μl (50ng)

T4 DNA Ligase

0.5μl

wxya 2 o

20μl

[0071] Ligate overnight at 16°C.

[0072] 5. Cloning construction (transforma...

Embodiment 2

[0100] Example 2 transgene

[0101] 1. Collection of fertilized eggs

[0102] (1) Select F1 (DBA / 2 female × C57BL / 6 male) female mice that are sexually mature at 4 weeks, inject 5 IU of pregnant horse serum gonadotropin (PMSG) intraperitoneally, and then inject 5 IU human Chorionic gonadotropin (hCG) in the same mouse, superovulate female mice. The hCG-injected female mice were quickly caged with C57BL / 6J mice.

[0103] (2) Check the thrombus on the second day, kill the female mouse that sees the thrombus, open the abdominal cavity of the mouse, fully expose the abdominal cavity and uterine horn, and carefully cut off the oviduct and part of the uterine horn under a dissecting microscope to place M2 and hyaluronic acid Acid mixture in a 35mm dish. When the enlarged ampullary area is torn open with ophthalmic forceps, free fertilized eggs can be seen gushing out. Under the action of hyaluronidase, some clustered cell clusters will disperse into single cells.

[0104] (3) Tr...

Embodiment 3

[0114] Embodiment 3 mouse genotype identification

[0115] 1. Use sterilized scissors to cut and number the toes of the mice within two weeks of birth, and put the cut toes into 1.5ml EP tubes with corresponding numbers.

[0116] 2. Add 100 μl mouse tail digestion solution (1ml GNTK+5μl 20mg / ml Proteinase K) to the EP tube. Centrifuge, 12000rpm, 5min. It was then placed in a 55°C water bath for overnight digestion.

[0117] 3. Boil the digested rat tail for 15 minutes to inactivate Proteinase K. Centrifuge, 12000rpm, 2min. The supernatant after centrifugation is the PCR template.

[0118] 4. Prepare the PCR reaction system and select the corresponding program for the reaction. Afterwards, gel was run for band analysis.

[0119] 1. PCR primer sequence:

[0120] OXTR:AATGCCCTGGCTCACAAATAC (Forward), as shown in SEQ ID No.5

GGGACAGCTATGACTGGGAGTAG (Reverse), as shown in SEQ ID No.6

The resulting fragment size was 456bp.

[0121] 2. Reaction sys...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of biology, in particular to application of a gene and a construction method of an animal model. The invention discloses an Oxtr gene which can be used asa target gene for treating breast cancer; oxytocin receptor (OXTR) overexpression provides a transgenic mouse breast cancer induction model, and the model can be used for the study of the pathogenesismechanism of breast cancer and also can be used for drug screening and drug function test.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of genes and the construction method of animal models. Background technique [0002] Breast cancer is the malignant tumor with the highest incidence rate in women, threatening the life and health of women all over the world. Every year, more than 1.67 million women suffer from breast cancer worldwide, and 52.9% of them occur in developing countries. Experimental animal models can replicate certain human diseases and are one of the important means of medical research. Experimental animal models of breast cancer play a key role in the study of the pathogenesis of breast cancer and the evaluation of drug effectiveness, and have broad prospects. [0003] The most commonly used animal models of breast cancer include mice, dogs, cats, etc., all of which can produce spontaneous breast cancer. Among them, the most commonly used animal model of transplantation is nude mice (...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85A01K67/027A61K45/00A61K49/00A61P35/00
CPCA01K67/0278A01K2217/072A01K2227/105A01K2267/0331A61K45/00A61K49/0008C07K14/723C12N15/85
Inventor 郑耀武李丹
Owner NORTHEAST NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap