Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice seed dormancy regulation gene OsMPK14 and application thereof

A technology for rice seeds and gene regulation, applied in the fields of biotechnology and crop genetic engineering, can solve problems such as unclear functional markers, inconvenient production and application, and affected traits.

Active Publication Date: 2018-05-18
RICE RES INST GUANGDONG ACADEMY OF AGRI SCI
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some of the dormancy-related genes that have been cloned affect other agronomic traits, such as qSD1-2; some functional markers are not clear, such as sdr4; resulting in inconvenient production and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice seed dormancy regulation gene OsMPK14 and application thereof
  • Rice seed dormancy regulation gene OsMPK14 and application thereof
  • Rice seed dormancy regulation gene OsMPK14 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019] The present invention will be described in further detail below in conjunction with the accompanying drawings and specific embodiments.

[0020] The present invention constructs the editing carrier Crisp-OsMPK14 of the OsMPK14 gene, and then introduces the editing carrier Crisp-OsMPK14 into the rice material WD with low seed dormancy and easy ear buds through the genetic transformation method mediated by Agrobacterium; In addition to the mutant strains, the homozygous offspring of the strains were obtained by subculture, and finally the seed dormancy of the newly harvested seeds was measured by measuring the germination rate. Specifically include the following steps:

[0021] 1. Construction of the editing vector Crisp-OsMPK14: refer to the CRISPR / Cas9 editing technology, select the target sequence "CCCATAAGCTCCTCGCCCGATGG" according to the base sequence of the OsMPK14 gene in the control material, and synthesize primers Cris6aF and Cris6aR according to the target seque...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the field of biotechnology and crop genetic engineering technology, the invention discloses a rice seed dormancy regulation gene OsMPK14 and application thereof. The rice seed dormancy regulation gene OsMPK14 disclosed by the invention plays an important role in improving rice seed dormancy, has a sequence shown as SEQ ID NO.2, and encodes a protein with amino acid sequence shown as SEQ ID NO.1. The application specifically includes CRISPR / Cas9 systematic editing, interference or knockout of OsMPK14 gene and destruction of the biological functions of OsMPK14 gene so as to obtain apreharvest sprouting resistant rice strain. The gene OsMPK14 knockout method provided by the invention can knock out the OsMPK14 gene of the existing material, by screening the knockout offspring, adormancy enhanced rice strain can be obtained, and the preharvest sprouting resistance can be effectively improved.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and crop genetic engineering, in particular to a rice seed dormancy regulation gene OsMPK14 and its application. Background technique [0002] Materials with weak seed dormancy have weak panicle germination resistance, which is not conducive to agricultural production. In the Yangtze River Basin and South China, the main rice producing areas in my country, the harvest season of early indica rice just catches up with the local plum rain season, and the environmental conditions of high temperature and high humidity are more likely to cause panicle germination. According to data statistics, the annual loss rate of my country's rice due to panicle germination is more than 5%, seriously affecting the yield and quality of early rice paddy. In the seed production process of hybrid rice in southern my country, gibberellin is widely used, which weakens the dormancy of seeds, and the high temperatur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8267
Inventor 毛兴学刘斌王丰张建军柳武革
Owner RICE RES INST GUANGDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com