Rice seed dormancy regulation gene OsMPK14 and application thereof
A technology for rice seeds and gene regulation, applied in the fields of biotechnology and crop genetic engineering, can solve problems such as unclear functional markers, inconvenient production and application, and affected traits.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0019] The present invention will be described in further detail below in conjunction with the accompanying drawings and specific embodiments.
[0020] The present invention constructs the editing carrier Crisp-OsMPK14 of the OsMPK14 gene, and then introduces the editing carrier Crisp-OsMPK14 into the rice material WD with low seed dormancy and easy ear buds through the genetic transformation method mediated by Agrobacterium; In addition to the mutant strains, the homozygous offspring of the strains were obtained by subculture, and finally the seed dormancy of the newly harvested seeds was measured by measuring the germination rate. Specifically include the following steps:
[0021] 1. Construction of the editing vector Crisp-OsMPK14: refer to the CRISPR / Cas9 editing technology, select the target sequence "CCCATAAGCTCCTCGCCCGATGG" according to the base sequence of the OsMPK14 gene in the control material, and synthesize primers Cris6aF and Cris6aR according to the target seque...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap