Method for creating red rice strain by targeting Rc gene by using gene edition technique

A gene editing and gene technology, applied in the field of gene editing, can solve the problems of low international competition and few high-quality rice varieties, and achieve the effect of high-efficiency breeding methods

Active Publication Date: 2018-11-16
BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the genetic research and breeding practice of rice quality traits is a weak link in my country's rice scientific research, resulting in the current situation that my country has few high-quality rice varieties and low international competition

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for creating red rice strain by targeting Rc gene by using gene edition technique
  • Method for creating red rice strain by targeting Rc gene by using gene edition technique
  • Method for creating red rice strain by targeting Rc gene by using gene edition technique

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Sequence analysis of rice Rc gene and gene editing target design

[0030] The sequence of rice Rc gene is shown in sequence 1. Sequence analysis shows that the gene contains 7 exons, respectively 1-95 (first exon), 415-720 (second exon), 3418-3514 (third exon) in the sequence table. exon), 3748-3762 (fourth exon), 3903-3959 (fifth exon), 4162-4711 (sixth exon), 4882-5198 (seventh exon ).

[0031] The Rc genes of the two white rice varieties Xiushui 134 and Gangyou 8518 tested in the present invention both had 14 base mutations at exon 5183 of the seventh exon. Therefore choose to design two cas9 recognition sites here according to the principle of the present invention, as figure 1 . The recognition target sequences were: (gRNA1) GCGCAAGTGGATGCCATCCAAGG and (gRNA2) CCATCCAAGGTGATTTCAGTGCC.

Embodiment 2

[0032] Example 2: Construction of Targeting Vector and Genetic Transformation of Rice

[0033] The gene editing technology used in this experiment is CRISPR / cas9, the third-generation gene editing technology. The vector used is the artificially synthesized recombinant plasmid pCXUN-Cas9-gRNA (circular vector), and the backbone vector pCXUN-Cas9 is a common linear vector ordered on the market. (This experiment was purchased from Beijing Weishang Lide Biotechnology Co., Ltd.), the full-length cas9 protein sequence is 4206 base pairs, encoding 1401 amino acids. Its expression is driven by the Ubiquitin promoter and the gRNA is driven by the U6 promoter. The gRNA fragment was synthesized by Primer Synthesis Company and connected to the U6 promoter by DNA ligase to form the recombinant plasmid pCXUN-Cas9-gRNA (circular vector).

[0034] In the present invention, the vector pCXUN-Cas9-gRNA is used to transform the callus of japonica rice, indica rice and glutinous rice as the accep...

Embodiment 3

[0040] Example 3: Genotype detection and phenotype investigation of Rc gene edited body

[0041] A) Obtained genotype and phenotype of target gRNA1

[0042] The genomic DNA of transformed plants was extracted, and the transgenic plants were identified by PCR amplification with primers CZTF-F (5'-GGGAGATCCAGCTAGAGGTC-3') and CZTF-F (5'-GGAAGGAGGAAGACAAGG-3'). Further use primer Rc-F: 5'-CAATCCTACATTACAACACGCTG-3'; Rc-R: 5'-CATTCCGAAATAGTGAACCCT-3', PCR amplify the genomic DNA of the transgenic plant identified above, obtain the Rc gene fragment with the target sequence, and send Go to the company for sequencing. According to the analysis of the sequencing results, the target gRNA1-mediated gene editing obtained 15 and 9 types of Rc genotypes in the two materials respectively, such as figure 2 Some deletion types are listed, and the genotypes of each of the two clones (XS134-4, XS134-5, HH851-5, HH851-6) are restored due to the deletion of bases at the frameshift mutation pos...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for creating a red rice strain by targeting a Rc gene by using a gene edition technique. The method comprises the following steps: editing sequences of a rc gene frameshift mutation point by using a gene edition technique, screening and collecting an RC genotype with function recovery, and successfully improving rice colors of two materials, namely nonglutinous rice Gangyou 8518 and japonica rice Xiushui 134. By adopting the method, an efficient breeding mode is provided for creating red rice germplasm resources and culturing excellent red rice varieties.

Description

technical field [0001] The invention relates to the technical field of gene editing, in particular to a method for repairing the Rc mutant gene and creating a red rice strain with the CRISPR / Cas9 gene editing technology. Background technique [0002] In recent years, the rapid development of genome editing technology provides an efficient auxiliary tool for rice gene function research and genetic breeding improvement. It uses site-specific nucleases to cause double-strand breaks in plant genomic DNA sequences, and stimulates the cell's own homologous recombination and non-homologous end-joining repair mechanisms, by randomly adding or deleting the number of bases in the target sequence. The targeted modification of the plant genome is completed, so the targeted editing of the target DNA sequence can be realized. In rice, this technology has achieved the knockout of many negative regulatory genes to improve favorable agronomic traits, which has played a strong role in promot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82C12N15/29A01H5/10A01H6/46
CPCC12N15/8213C12N15/825C07K14/415C12N2810/10
Inventor王锋朱义旺林雅容陈在杰梅法庭胡太蛟张柱坚陈建民范美英
OwnerBIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI