Cynoglossus semilaevis disease-resistant immune related gene and application thereof

A semi-smooth tongue sole and genetic technology, applied in the fields of application, genetic engineering, immunoglobulin, etc., can solve the problems of disease resistance that have not been reported yet

Active Publication Date: 2018-05-29
YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the existence of some active substances such as immunoglobulins and enzymes has been detected in fish skin mucu

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cynoglossus semilaevis disease-resistant immune related gene and application thereof
  • Cynoglossus semilaevis disease-resistant immune related gene and application thereof
  • Cynoglossus semilaevis disease-resistant immune related gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Cloning and sequence analysis of the full-length cDNA of the IgT gene of half-smooth tongue sole

[0032]1. Cloning of the full-length cDNA sequence: The applicant Chen Songlin et al. discovered the partial mRNA sequence of the IgT gene of the half-smooth tongue sole through immune tissue (spleen, etc.) transcriptome sequencing and bioinformatics analysis of the disease-resistant family of half-smooth tongue sole. The full-length cDNA sequence of the immunoglobulin IgT gene of half smooth tongue sole was obtained by alignment and RACE amplification with the genome sequence of half smooth tongue sole obtained by their sequencing. The four RACE primer sequences used for RACE amplification are:

[0033] IgT‐GSP‐5: 5'‐GTGCTGTTTTTGATGTGCTGTCCGTCT‐3';

[0034] IgT‐NGSP‐5: 5'‐ACATCGGCAGAGACAGGTTG‐3';

[0035] IgT‐GSP‐3: 5'‐ATCACTTGGTCTGAACACGACGGCAC‐3';

[0036] IgT-NGSP-3: 5'-GAAGACAAAGCAGGGCTACTTG-3'.

[0037] 2. Sequence splicing and alignment analysis: use E...

Embodiment 2

[0039] Example 2: Analysis of the expression pattern of the IgT gene of half-smooth tongue sole in the immune tissues of normal fish and fish infected by Vibrio harveyi

[0040] Real-time quantitative PCR was used to detect the expression level of IgT gene in muscle, heart, intestine, kidney, head kidney, liver, spleen, gill, skin and blood of normal half-smooth tongue sole, and the expression pattern of the gene in different tissues was studied; The real-time quantitative PCR method was used to detect the expression level of IgT gene in six immune-related tissues of liver, kidney, spleen, intestine, gill and skin before and after infection with Vibrio harveyi, and the relationship between the gene and the immune response of tongue sole was analyzed .

[0041] 1. Firstly, take 10 tissues of normal half-smooth tongue sole, which are muscle, heart, intestine, kidney, head kidney, liver, spleen, gills, skin and blood, and put them into a centrifuge tube containing 1ml immediately...

Embodiment 3

[0043] Example 3: Analysis of the expression patterns of IgT genes in different tissues of tongue sole disease-resistant and susceptible families

[0044] 1. Production of resistant and susceptible families of tongue sole

[0045] The tongue sole family was established using the method previously invented by applicant Chen Songlin (Chen Songlin et al., 2010). When the fry of tongue sole family grew to 8-15cm, the fry of each family were infected with Vibrio harveyi by intraperitoneal inoculation. Infection experiments were performed according to previously established methods. Each family randomly selects 80-150 fish fry for formal infection experiments, and the fish fry for infection are cultured in 2-3 cubic meters of glass fiber reinforced plastic tanks. After infection, observe and record the state and death number of fry of each family every day. After the onset of pathogenic bacteria infection, collect the experimental fish that are on the verge of death or just died, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Protein molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention aims to provide a cynoglossus semilaevis disease-resistant immune related gene. In the cynoglossus semilaevis disease-resistant immune related gene, the amino acid sequence is SEQ ID NO:1, and the nucleotide sequence of the coding gene is SEQ ID NO:2. A cynoglossus semilaevis IgT gene is cloned for the first time, the cDNA sequence is obtained, the PCR primer of expression detectionis designed, and a method for detecting skin mucus, extracting total RNA in the mucus and detecting the expression of the IgT gene as well as a method of applying the expression level of the IgT genein the skin mucus as a disease resistance evaluation index are created, so that a molecular method for performing non-destructive detection on the disease resistance of the cynoglossus semilaevis is created and can be applied to cynoglossus semilaevis disease resistance test and disease-resistant fine seed breeding. The technical method can be popularized and applied to other fishes.

Description

technical field [0001] The invention belongs to the technical field of aquatic genetics and breeding, and in particular relates to a disease-resistant immune-related gene of half-smooth tongue sole and its application in disease resistance evaluation. Background technique [0002] Semi-smooth tongue sole is mainly distributed in the coastal areas of my country. It is an important seawater economically farmed fish in my country. It is very popular because of its delicious meat and high nutritional value. In recent years, the aquaculture industry of tongue sole in my country has developed rapidly, the aquaculture scale has continued to expand, and the aquaculture output has also increased year by year. It has become one of the leading aquaculture species in my country. However, with the rapid development of semi-smooth tongue sole aquaculture, more and more problems have begun to be exposed, the most serious of which is the frequent outbreak of diseases caused by high-density ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K16/00C12N15/13C12Q1/6888
CPCC07K16/00C12Q1/6888C12Q2600/124C12Q2600/158
Inventor 陈松林王双艳王磊王洁周茜陈张帆崔忠凯杨英明
Owner YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap