Cynoglossus semilaevis disease-resistant immune related gene and application thereof
A semi-smooth tongue sole and genetic technology, applied in the fields of application, genetic engineering, immunoglobulin, etc., can solve the problems of disease resistance that have not been reported yet
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Cloning and sequence analysis of the full-length cDNA of the IgT gene of half-smooth tongue sole
[0032]1. Cloning of the full-length cDNA sequence: The applicant Chen Songlin et al. discovered the partial mRNA sequence of the IgT gene of the half-smooth tongue sole through immune tissue (spleen, etc.) transcriptome sequencing and bioinformatics analysis of the disease-resistant family of half-smooth tongue sole. The full-length cDNA sequence of the immunoglobulin IgT gene of half smooth tongue sole was obtained by alignment and RACE amplification with the genome sequence of half smooth tongue sole obtained by their sequencing. The four RACE primer sequences used for RACE amplification are:
[0033] IgT‐GSP‐5: 5'‐GTGCTGTTTTTGATGTGCTGTCCGTCT‐3';
[0034] IgT‐NGSP‐5: 5'‐ACATCGGCAGAGACAGGTTG‐3';
[0035] IgT‐GSP‐3: 5'‐ATCACTTGGTCTGAACACGACGGCAC‐3';
[0036] IgT-NGSP-3: 5'-GAAGACAAAGCAGGGCTACTTG-3'.
[0037] 2. Sequence splicing and alignment analysis: use E...
Embodiment 2
[0039] Example 2: Analysis of the expression pattern of the IgT gene of half-smooth tongue sole in the immune tissues of normal fish and fish infected by Vibrio harveyi
[0040] Real-time quantitative PCR was used to detect the expression level of IgT gene in muscle, heart, intestine, kidney, head kidney, liver, spleen, gill, skin and blood of normal half-smooth tongue sole, and the expression pattern of the gene in different tissues was studied; The real-time quantitative PCR method was used to detect the expression level of IgT gene in six immune-related tissues of liver, kidney, spleen, intestine, gill and skin before and after infection with Vibrio harveyi, and the relationship between the gene and the immune response of tongue sole was analyzed .
[0041] 1. Firstly, take 10 tissues of normal half-smooth tongue sole, which are muscle, heart, intestine, kidney, head kidney, liver, spleen, gills, skin and blood, and put them into a centrifuge tube containing 1ml immediately...
Embodiment 3
[0043] Example 3: Analysis of the expression patterns of IgT genes in different tissues of tongue sole disease-resistant and susceptible families
[0044] 1. Production of resistant and susceptible families of tongue sole
[0045] The tongue sole family was established using the method previously invented by applicant Chen Songlin (Chen Songlin et al., 2010). When the fry of tongue sole family grew to 8-15cm, the fry of each family were infected with Vibrio harveyi by intraperitoneal inoculation. Infection experiments were performed according to previously established methods. Each family randomly selects 80-150 fish fry for formal infection experiments, and the fish fry for infection are cultured in 2-3 cubic meters of glass fiber reinforced plastic tanks. After infection, observe and record the state and death number of fry of each family every day. After the onset of pathogenic bacteria infection, collect the experimental fish that are on the verge of death or just died, ...
PUM
Property | Measurement | Unit |
---|---|---|
Protein molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com