Unlock instant, AI-driven research and patent intelligence for your innovation.

Mycobacterium tuberculosis h37rv coding gene and its application

A technology of Mycobacterium tuberculosis and coding genes, which is applied in the fields of application, genetic engineering, and plant gene improvement, etc. It can solve the problem of poor detection specificity, sensitivity, and simplicity, high rate of false positives, and wrong termination sites at the molecular level. And other issues

Active Publication Date: 2021-06-08
BEIJING PROTEOME RES CENT
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the three types of methods have their own advantages, they also have disadvantages, such as the long period of traditional isolation and culture and the low culturability of bacteria; the current molecular level detection is still poor in specificity, sensitivity and simplicity; Composition characteristic analysis is costly and complicated to operate
However, since MTB belongs to prokaryotes, due to the deficiencies of prokaryotic genome annotation technology itself, there may still be annotation errors in genome annotation (over-annotation, gene boundary errors, and ORF start and end site errors, alternative splicing, ribosome displacement, missing annotations), which has brought troubles to the in-depth and accurate analysis of biological mechanisms
To solve this problem, Proteogenomics has been used to correct the annotated genes of H37Rv, however, the high rate of false positives, conventional techniques are difficult to predict annotation genes, new gene verification, new gene function analysis and its application, etc. are the challenges faced by the field
[0005] In general, the traditional identification strategy of Mycobacterium tuberculosis complex (MTBC) has the defects of long period, cumbersome steps, low specificity and sensitivity, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycobacterium tuberculosis h37rv coding gene and its application
  • Mycobacterium tuberculosis h37rv coding gene and its application
  • Mycobacterium tuberculosis h37rv coding gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Searching for missing annotation coding genes in the H37Rv strain genome

[0034]1.1 High-coverage proteome verification of the H37Rv strain genome

[0035] A deep coverage study of the proteome was performed on the H37Rv strain using high-coverage proteome technology. Based on the Tuberculosis (20160307) database, the genome was annotated and encoded using the pFind 3 engine. In order to discover new protein coding regions, based on proteomics technology, we used pAnno software to translate the six-reading frame database of H37Rv's genome (NC_000962.3) file published by NCBI, and used this database to perform mass spectrometry data for new peptides. Segments and identification of new proteins. In order to reduce the false positive rate, we used three filtering methods for separately estimating category FDR for annotated peptides and new peptides during the data filtering process, namely S-FDR, T-FDR I and T-FDRII.

[0036] After data analysis, we identifi...

Embodiment 2

[0051] Embodiment 2: Establish the method for identifying MTBC complex group

[0052] (1) Design primers:

[0053] Based on the CDS sequence of the Rv3108c (-|3476972-3477175|) gene shown in SEQ ID NO.1, PCR primers were designed using Oligo7.0, and the primer sequences are as follows:

[0054] F: 5'-GACCAGTGCCCTCGCAGT-3' (SEQ ID NO.4);

[0055] R: 5'-AGGACGATCATGGCTCCG-3' (SEQ ID NO.5)

[0056] The positional relationship between the above primers and the Rv3108c (-|3476972-3477175|) gene is shown below, where the corresponding positions of the primers are underlined.

[0057] ATGCCAGGCAAGGAAATCGATCGAGTCCGGGCGACCAGTGCCCTCGCAGTGATTAGGCAGCACCCGGTAATGGTGTTCTTCGCGCTGTCGCCGGTACTCGCCGCATTGGGTGTCATGTGGTGGCTAGCCGGTGCTGGATGGGCTATCGTCGCGGCCCTGGTGCTGGTGGTCGTCGG CGGAGCCATGATCGTCCT CAAACGCTGA (SEQ ID NO.1)

[0058] (2) Extract the total DNA of the strains to be tested including M.tuberculosis H37Rv, 40 standard strains of Mycobacterium are preserved by the China Medical Bacteria Cult...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a mycobacterium tuberculosis H37Rv coding gene, which can be used as a standard gene for molecular identification of mycobacterium tuberculosis complex, and is used for molecular identification and clinical detection of mycobacterium tuberculosis complex.

Description

technical field [0001] The invention relates to the field of gene detection, in particular to the identification of pathogenic bacteria species. Background technique [0002] Mycobacterium tuberculosis (MTB) is the pathogenic bacterium that causes human tuberculosis. It can invade all organs of the body, but tuberculosis is the most common. Tuberculosis is an extremely important infectious disease, which seriously threatens human life and health. According to the WHO, about 8 million new cases occur each year and at least 3 million people die from the disease. The clinical strains of MTB are difficult to culture, grow slowly, can cross-infect with other mycobacteria, and it is difficult to distinguish tuberculosis from other respiratory infection symptoms, which brings great difficulties to rapid clinical diagnosis and treatment. Therefore, the establishment of a fast, accurate, specific, sensitive and cheap tuberculosis detection method is a necessary prerequisite for ef...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C12N15/11C12Q1/689C12Q1/04C12R1/32
CPCC07K14/35C12Q1/689
Inventor 徐平张瑶王富强孙金帅武舒佳常蕾
Owner BEIJING PROTEOME RES CENT