A method for differentiating mud crabs and mud crabs

A technology for Scylla serrata and Scylla serrata, which is applied in the field of identifying Scylla serrata and Scylla serrata, and can solve the problems of resource decline of wild blue crabs and imminent artificial breeding.

Active Publication Date: 2021-05-11
NINGBO UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The blue crab has the characteristics of large size, fast growth, strong adaptability, delicious meat, and rich nutrition. According to the trawling survey conducted by Chen Pimao and others in various reef areas from 2002 to 2004, the resource density of crabs is 180.985kg·km -2 , but the proportion of economic crabs is only 26.69%, and Scylla serrata, which has a high occurrence rate and high economic value in previous surveys, was not caught, so the artificial breeding of Scyllas is imminent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for differentiating mud crabs and mud crabs
  • A method for differentiating mud crabs and mud crabs
  • A method for differentiating mud crabs and mud crabs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Screening of Molecular Markers for Distinguishing Scylla pseudophylla and Scylla serrata

[0026] Obtain the mtDNA sequences of Scylla pseudocavena and Scylla serrata in the NCBI database, and use AlignX (a component of Vector NTI Suite 7.1) software to perform sequence alignment to find out the difference base region in Scylla; finally screen the obtained consensus Sequence, in the interval 13274-13362 of the consensus sequence, based on the consensus sequence, primers were designed, PCR was amplified and verified by sequencing, and the counted SNP position was 13334, a total of 1 SNP site. The sequence of the corresponding nucleotide fragment in Scylla paramamosain comprising the above SNP site is SEQ ID NO: 1:

[0027] AATTAAAAAACTAATGATTATGCTACCTTTGCACGGTCAAAATACCGCGGCTATTTAACA-TTTTTGTCAGTGAGCAGGCTAGACTATA;

[0028] The sequence of the corresponding nucleotide fragment in Scylla serrata (Scylla_serrata) is SEQ ID NO: 2:

[0029] AATTAAAAAACTAATGATTATGCT...

Embodiment 2

[0037]Example 2 Utilize SNP sites to identify blue crabs

[0038] The mud crabs used, mud crabs serrata, and mud crabs were collected from healthy individuals in Lulin Market, Ningbo City, China, and Sanmen County, China, respectively. The morphological identification was carried out according to the morphological characteristics of mud crabs studied by Lin Qi et al. Take 30 individuals of each variety, take swimming foot muscle tissue respectively, use phenol-chloroform method to extract genomic DNA, dilute the extracted DNA to 100ng / microliter, and use 1.5% agarose gel electrophoresis to detect its integrity, save Store at -20°C for later use.

[0039] PCR reactions were performed in a Roche Light Cycle 480 instrument. The reaction system is 20 microliters, including 10 microliters LC-HRM master Mix 10 microliters, forward and reverse primers 1.5 microliters, template DNA 1.2 microliters, grade H 2 O 3 µl. The reaction program was pre-denaturation at 95°C for 10 min, dena...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
densityaaaaaaaaaa
Login to view more

Abstract

The invention provides a method for identifying Scylla simulans and Scylla serrata, which is to extract a nucleic acid sample of a mud crab sample to be detected, and then use PCR primers to perform genotyping on the amplified nucleic acid sample; The sequence of the corresponding nucleotide fragment in crab is SEQ ID NO: 1: the sequence of the corresponding nucleotide fragment in Scylla serrata is SEQ ID NO: 2. The method established by the invention can effectively identify Scylla simulans and Scylla serrata, and it uses high-resolution melting curve HRM to classify the mud crab to be detected, so as to quickly and accurately identify the germplasm of the mud crab, which is the mud crab Provide technical support for nursery breeding.

Description

technical field [0001] The invention belongs to the technical field of genetic breeding assisted by molecular markers, and in particular relates to a method for identifying mud crabs and mud crabs. Background technique [0002] The genus Scylla belongs to the class Crustacea, order Decapode, suborder Brachyura, and family Portunidae. Widely distributed in the coastal waters of the Indian-West Pacific Ocean, including mangrove areas and estuary bays in Southeast Asia, Australia, Japan, India, South Africa, etc. In my country, it is mainly distributed in the coastal waters of Zhejiang, Fujian, Taiwan, Guangdong, Guangxi and Hainan . The blue crab has the characteristics of large size, fast growth, strong adaptability, delicious meat, and rich nutrition. According to the trawling survey conducted by Chen Pimao and others in various reef areas from 2002 to 2004, the resource density of crabs is 180.985kg·km -2 , but the proportion of economic crabs is only 26.69%, and Scylla s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/6888C12Q2600/156C12Q2527/107
Inventor 陈夏月李荣华王春琳母昌考宋微微叶央芳刘磊史策
Owner NINGBO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap