ICAM-1 (Intercellular Adhesion Molecule 1) gene knockout tumor cell strain and application thereof
An ICAM-1 and cell line technology, applied in the field of gene editing, can solve the problems of time-consuming and cumbersome, and achieve the effect of strong practicability, shortening the experimental operation period, and obvious anti-tumor adhesion ability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] 1. CRISPR / Cas9 system knockout target sgRNA design
[0035] Choose CRISPR Design from Zhang Feng's experimental group: http: / / crispr.mit.edu / . Select the CDS region sequence of ICAM-1, and only use one of the exon sequences for each design, so as to avoid the designed sgRNA spanning two exons and failing to match the corresponding sequence on the genome. A 20bp Oligo DNA (sgRNA) was obtained by design: TTTCTCGTGCCGCACTGAAC.
[0036] During synthesis, it is necessary to add complementary bases (in bold) after digestion with BbsI before and after the sequence, so that it can be directly connected to the knockout vector after digestion.
[0037] Positive strand sgRNA: CACCGTTTCTCGTGCCGCACTGAAC;
[0038] Negative strand sgRNA: AAAC GTTCAGTGCGGCACGAGAAA C.
[0039] 2. Construction of ICAM-1 gene knockout recombinant vector
[0040] 1) Synthesize 2OD, dissolve to 100μM. Use 2 μL each, and the single-stranded Oligo annealing steps are as follows:
[0041]
[0042] Eac...
Embodiment 2
[0066] Example 2 Application of ICAM-1 Knockout
[0067] ICAM-1, as a cell adhesion factor, plays an important role in the initial steps of tumor metastasis. Through the tumor and intravascular cell adhesion experiment: use vascular endothelial cells HUEVC to plate in 96-well plates, 37 ℃, 5% CO2 incubator, adhere to the wall for 12 hours. Divided into two groups, two groups were added and no stimulation factor TNF-α group (TNF-α can induce ICAM-1 expression increased), the two groups were added 100 μL fluorescent dye-labeled wild-type tumor cells and ICAM-1 1 Knockout tumor cells (3×10 4 / mL) culture medium suspension, washed 3 times with PBS solution to wash away non-adhered cells. A total of four groups were photographed under a fluorescent microscope to calculate the inhibition rate of drug on cell adhesion. We found that the adhesion ability of ICAM-1 knockout tumor cells was significantly reduced, which was significantly reduced after adding stimulating factors. The r...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com