Supercharge Your Innovation With Domain-Expert AI Agents!

ICAM-1 (Intercellular Adhesion Molecule 1) gene knockout tumor cell strain and application thereof

An ICAM-1 and cell line technology, applied in the field of gene editing, can solve the problems of time-consuming and cumbersome, and achieve the effect of strong practicability, shortening the experimental operation period, and obvious anti-tumor adhesion ability.

Inactive Publication Date: 2018-08-31
FUZHOU UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After using CRISPR / Cas9 technology to knock out the target gene, the commonly used limited dilution method is too cumbersome and time-consuming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ICAM-1 (Intercellular Adhesion Molecule 1) gene knockout tumor cell strain and application thereof
  • ICAM-1 (Intercellular Adhesion Molecule 1) gene knockout tumor cell strain and application thereof
  • ICAM-1 (Intercellular Adhesion Molecule 1) gene knockout tumor cell strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. CRISPR / Cas9 system knockout target sgRNA design

[0035] Choose CRISPR Design from Zhang Feng's experimental group: http: / / crispr.mit.edu / . Select the CDS region sequence of ICAM-1, and only use one of the exon sequences for each design, so as to avoid the designed sgRNA spanning two exons and failing to match the corresponding sequence on the genome. A 20bp Oligo DNA (sgRNA) was obtained by design: TTTCTCGTGCCGCACTGAAC.

[0036] During synthesis, it is necessary to add complementary bases (in bold) after digestion with BbsI before and after the sequence, so that it can be directly connected to the knockout vector after digestion.

[0037] Positive strand sgRNA: CACCGTTTCTCGTGCCGCACTGAAC;

[0038] Negative strand sgRNA: AAAC GTTCAGTGCGGCACGAGAAA C.

[0039] 2. Construction of ICAM-1 gene knockout recombinant vector

[0040] 1) Synthesize 2OD, dissolve to 100μM. Use 2 μL each, and the single-stranded Oligo annealing steps are as follows:

[0041]

[0042] Eac...

Embodiment 2

[0066] Example 2 Application of ICAM-1 Knockout

[0067] ICAM-1, as a cell adhesion factor, plays an important role in the initial steps of tumor metastasis. Through the tumor and intravascular cell adhesion experiment: use vascular endothelial cells HUEVC to plate in 96-well plates, 37 ℃, 5% CO2 incubator, adhere to the wall for 12 hours. Divided into two groups, two groups were added and no stimulation factor TNF-α group (TNF-α can induce ICAM-1 expression increased), the two groups were added 100 μL fluorescent dye-labeled wild-type tumor cells and ICAM-1 1 Knockout tumor cells (3×10 4 / mL) culture medium suspension, washed 3 times with PBS solution to wash away non-adhered cells. A total of four groups were photographed under a fluorescent microscope to calculate the inhibition rate of drug on cell adhesion. We found that the adhesion ability of ICAM-1 knockout tumor cells was significantly reduced, which was significantly reduced after adding stimulating factors. The r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to related study fields of cytobiology, molecular biology and the like and discloses an ICAM-1 (Intercellular Adhesion Molecule 1) gene knockout tumor cell strain and applicationthereof. The invention discloses sgRNA (Small Guide Ribonucleic Acid) which targets to a PAM (Protospacer Adjacent Motif) site of an ICAM-1 gene of a human genome; through transfection recombinant CRISPR plasmid transfection, the ICAM-1 gene of a HelA cell can be efficiently knocked out; through resistance screening with puromycin, a conventional limiting dilution method is not used in the screening process, but a relatively convenient and concise monoclonal picking method is used instead, and thus the experiment cycle is greatly shortened. With the ICAM-1 knockout cell strain, a novel research platform is established for studying adhesion and metastasis process of tumor cells, experiments show that the adhesion property of HeLa is remarkably degraded after ICAM-1 is knocked out, molecular mechanisms of mutual actions of ICAM-1 with different cell factors can be studied, and meanwhile treatment mechanisms and molecular targets related to anti-metastasis medicines can be well studied.

Description

technical field [0001] The invention belongs to the technical field of gene editing and relates to molecular biology, in particular to constructing an ICAM-1 gene knockout tumor cell line based on CRISPR / Cas9 technology and its application. Background technique [0002] Postoperative recurrence and metastasis of tumor cells is the main cause of high mortality in cancer patients, and there is no effective prevention and treatment method. For example, the recurrence rate after radical resection of liver cancer is as high as 60%-80%, and the high recurrence rate after surgery has become the main obstacle affecting the rehabilitation after liver cancer surgery. [0003] Human breast cancer (HeLa) cells are a classic model cell for the study of tumor adhesion and metastasis. Traditional gene editing tools can only transiently silence or knock down target genes. After using CRISPR / Cas9 technology to knock out the target gene, the commonly used limiting dilution method is too cumb...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/66C12N15/85C12N5/10
CPCC12N5/0693C12N15/113C12N15/66C12N15/85C12N2510/00C12N2800/107
Inventor 邵敬伟张冰晨
Owner FUZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More