Corynebacteria inducible promoter, expression vector comprising same, and application thereof
A coryneform, inducible technology, applied in vectors, nucleic acid vectors, viruses/phages, etc., can solve the problems of low yield, increased steps, by-products, cost, and high cost, and achieves the effect of solving low efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Inositol-inducible promoter P iol build
[0035] Using PCR technology to use Corynebacterium glutamicum 13032 genomic DNA as a template,
[0036] Utilize primers iolR-F and iolR-R and iolT-F and iolT-R to amplify iolR gene and iolT upstream 500bp sequence P iolT500 , PCR conditions were 94°C for 5min for one cycle, 94°C for 30s, 55°C for 30s, 72°C for 40s for 30 cycles, and 72°C for 10min for one cycle, and the reaction system was 50 μL. The PCR product was purified and recovered by 1% agarose gel electrophoresis.
[0037] iolR-F: 5'TCAGTTAACATGACCACCGAAGCTCCCA3'
[0038]iolR-R: 5'GCGGGTTCAGGGGGTGATTACCTGGCCACCAGGTGG3'
[0039] iolt-F: 5' TCACCCCCTGAACCCGC 3'
[0040] iolt-R: 5'CTAGAAGCTTCTTGTCTCCTAAGTTTGTCGTGCC 3'
[0041] Using the above sequence as a template, use primers iolR-F and iolT-R to carry out overlapping PCR. The conditions are 94°C for 5min for 1 cycle, 94°C for 30s, 55°C for 30s, 72°C for 40s for 30 cycles, and 72°C for 10min for 1 cycle....
Embodiment 2
[0042] Example 2: Construction of inositol-induced expression plasmid pIol
[0043] After double-cutting Example 1 with restriction endonucleases Hpa I and Hind III, pXMJ19 was double-cut with restriction endonucleases Hpa I and Hind III to remove its original promoter P tac and lacIq, and then the two were connected by T4 ligase and then transformed into E. coli DH5α, and the inositol-induced expression plasmid pIol was obtained after screening. The schematic diagram of the construction of inositol-induced expression plasmid pIol is as follows: figure 1 shown.
Embodiment 3
[0044] Example 3: Construction of 5-aminolevulinic acid production plasmid pIolhemAL
[0045] Using the genomic DNA of Corynebacterium glutamicum 13032 as a template, the hemA and hemL gene fragments were amplified using primers hemA-F, hemA-R, hemL-F and hemL-R. The PCR conditions were 1 cycle at 94°C for 5 min, 30 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 40 s, and 1 cycle at 72°C for 10 min, and the reaction system was 50 μL. Purify and recover the PCR product after 1% agarose gel electrophoresis to obtain hemA and hemL.
[0046] hemA-F: 5'CGCGGATCCATGGTGAGTGTACTCATCGTAGGG3'
[0047] hemA-R: 5'TTACTCCCTCGTTTGTGTGGC 3'
[0048] hemL-F:
[0049] 5'GCCACACAAACGAGGGAGTAAGCACCCAAAAACACTATTGACCA3'
[0050] hemL-R: 5'CGGGGTACCTCATGATGCCTTCGCTTCTGC 3'
[0051] The gene fragments hemA and hemL were used as templates, and primers hemA-F and hemL-R were used to carry out overlapping PCR to obtain hemA-hemL fragments.
[0052] After hemA-hemL was double-cut by BamH I a...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com