Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene for regulating number of nodules of nodule plants and application of gene to efficient nitrogen fixation aspect

A nodule, plant technology, applied in the fields of biotechnology and botany, can solve problems such as acidification, destruction of ecological balance, and polluted soil

Active Publication Date: 2018-09-28
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF9 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Excessive application of nitrogen fertilizers has caused serious environmental problems such as surface and groundwater pollution and soil acidification, which has become one of the important reasons for destroying ecological balance and seriously threatens the sustainable development of agriculture in my country.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for regulating number of nodules of nodule plants and application of gene to efficient nitrogen fixation aspect
  • Gene for regulating number of nodules of nodule plants and application of gene to efficient nitrogen fixation aspect

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0063] As one embodiment of the present invention, an interfering molecule that specifically interferes with the transcription of the Rac1 gene is used to down-regulate the expression of the gene. Methods of small molecule interference include but are not limited to: gene silencing regulated by miRNA, cosuppression caused by positive sense RNA (Cosuppression), antisense RNA suppression, virus-mediated gene silencing (Virus Induced Gene Silencing, VIGS), shRNA, dsRNA, Small interfering RNA, gene silencing mediated by hairpin RNA (hairpinRNA, hpRNA), etc., can also be applied in the present invention. In a preferred example, the interference molecule is targeted at positions 135-472 of the gene encoding the polypeptide according to claim 1 .

[0064] As an embodiment of the present invention, the gene encoding Rac1 is knocked out by knocking out the Rac1 gene. For example, the CRISPR / Cas9 system is used for gene editing to knock out the Rac1 gene. As another embodiment of the ...

Embodiment 1

[0117] Cloning of embodiment 1, Rac1 gene

[0118] In order to obtain genes that regulate the root nodules of legumes, the inventors screened a large number of genes, and after repeated research and testing, found that the Rac1 gene has a regulatory effect on controlling the number of soybean root nodules.

[0119] The nucleotide sequence of the Rac1a gene is shown in SEQ ID NO:1, and the encoded amino acid is shown in SEQ ID NO:3. The nucleotide sequence of the Raclb gene is shown in SEQ ID NO:2, and the encoded amino acid is shown in SEQ ID NO:4. Both have a high degree of sequence identity.

[0120] SEQ ID NO:1

[0121]ATGATGAATGCTTCAAAGTTCATTAAATGTGTTACTGTTGGAGATGGAGCTGTTGGGAAAACCTGCATGCTCATTTGCTACACCAGCAACAAGTTCCCCACTGATTACATACCAACAGTATTTGATAATTTTAGTGCCAATGTTGCTGTGGATGGAAGCATTGTCAATTTGGGGCTATGGGACACAGCAGGCCAGGAAGACTACAGCAGGTTGAGGCCATTGAGTTATAGAGGAGCAGACATTTTTGTCTTAGCATTCTCACTGATTAGCAGAGCTAGCTATGAAAATGTTCTCAAGAAGTGGATGCCGGAATTGCGTAGATTTGCACCTAATGTTCCAATTGTTCTTGTTGGTACAAA...

Embodiment 2

[0128] Example 2, Nodule phenotype analysis after silencing the Rac1 gene

[0129] Since the nucleotide sequences of Rac1a and Rac1b have a high degree of homology, when designing RNAi primers, the inventors obtained a target position for simultaneously silencing both Rac1a and Rac1b.

[0130] The constructed recombinant plasmid vector was transferred into Agrobacterium rhizogenes A.rhizogenes K599 to transform soybean hairy roots, and the co-cultivated soybean plants were transplanted into sterilized vermiculite for rooting and growth for 7 days, and the rhizobia B. japonicumUSDA110 Soybean plants were infected, and the number of nodules on soybean hairy roots 21 days after inoculation was counted, and the difference in the number of nodules was tested using the Student T-test method using Microsoft Excel 2010 software.

[0131] After infection with rhizobia B. japonicum USDA110, the phenotypes of Rac1-RNAi and empty vector plants were as follows: figure 1 As shown, A is the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene for regulating the number of nodules of nodule plants and an application of the gene to an efficient nitrogen fixation aspect. The inventor clones a novel gene namely an Rac1 gene for the first time. Shown by functional analysis, the gene or a regulating molecule thereof is closely related to the number of the nodules of the nodule plants. Therefore, the gene can beapplied to plant improvement, so that plants of which the nodule character and the nitrogen fixation character are changed are obtained.

Description

technical field [0001] The invention belongs to the fields of biotechnology and botany; more specifically, the invention relates to a gene regulating the nodule number of root-nodulated plants and its application in high-efficiency nitrogen fixation. Background technique [0002] Nitrogen is an essential macroelement for plant growth and a limiting factor for agricultural production. At present, more than half of the food in the world is obtained through the application of chemical fertilizers (especially nitrogen fertilizers), and 40-60% of crop yields (even up to 90% in tropical soils) are also attributed to the use of nitrogen fertilizers. Excessive use of nitrogen fertilizers not only increases Production costs, but also caused a heavy burden on the environment. Every year, about 40% of the nitrogen fertilizer that is not used by plants is directly deaminated to form N 2 return to the atmosphere, resulting in a serious waste of energy and resources; secondly, the N pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N5/10A01H5/00C12Q1/6895
CPCC12N15/8261C12Q1/6895C07K14/415C12Q2600/158
Inventor 王二涛高锦鹏张晓伟杨军
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com