Common wild rice root-specific promoter orrsgp and its application
A promoter, rice root technology, applied in the field of plant genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1. Cloning of OrRSGp specific expression fragment from Oryza sativa root
[0028] The genomic DNA of common wild rice was extracted by the CTAB method as a template, and the following amplification primers FP and RP were used as primers for PCR amplification. The reaction system was 50 μL.
[0029] Amplification primer sequence:
[0030] FP: 5'ACGCGTAAGGGGATCCTGGCAAAGCAAGGATTGCTTA 3';
[0031] RP:5’GATCTACCATGAATTCCATGTTTCAAATCAGAGTGATTATCC 3’
[0032] The above PCR amplification reaction procedure is: 95°C pre-denaturation for 30sec, then 95°C denaturation for 30sec, 60°C annealing for 30sec, 72°C extension for 30sec, 35 cycles, and finally complete extension for 5min.
[0033] A 896bp PCR product was obtained, which was separated by 1.5% agarose gel electrophoresis ( figure 1 ), the fragment is recovered, after sequencing, the nucleotide sequence of the PCR product is sequence 1, and the fragment shown by the PCR product is named OrRSGP.
[0034] The above 50μL reaction s...
Embodiment 2
[0038] Example 2. Study on the function of OrRSGp specific expression fragment from Oryza sativa root
[0039] 1. Preparation of recombinant vector
[0040] The recombinant vector pBinGlyRed-GUS-OrRSGp used for transformation of Arabidopsis thaliana is to replace the OrRSGp shown in sequence 1 with pBinGlyRed-GUS (Zhao Zhiqiang et al., Cloning and identification of the promoter specific expression in the green tissue of common wild rice. Biotechnology Bulletin, 2017, ( 7): 51-57) The aMV35S promoter that drives GUS expression between the BamH I and EcoR I restriction sites of the vector to obtain the vector.
[0041] The recombinant vector pCAMBIA1305-OrRSGp used for rice transformation is to replace the OrRSGp shown in sequence 1 with pCAMBIA1305 (Wuhan Miaoling Biotechnology Co., Ltd., P1117, and the vector contains the GUS gene) vector to drive GUS expression between HindIII and NcoI sites aMV 35S promoter, the resulting vector.
[0042] 2. Application of promoter fragments to reg...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


