Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of protein TaNRT2.5 in regulation of plant root development

A plant root system, tanrt2.5 technology, applied in the biological field, can solve the problem of not knowing much about the mechanism of food crops, and achieve the effect of promoting the development of plant roots and increasing root biomass

Active Publication Date: 2018-10-02
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, although great progress has been made in the study of root development in Arabidopsis in recent years, little is known about the mechanisms involved in food crops such as wheat.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of protein TaNRT2.5 in regulation of plant root development
  • Application of protein TaNRT2.5 in regulation of plant root development
  • Application of protein TaNRT2.5 in regulation of plant root development

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1, the construction of transgenic TaNRT2.5 wheat

[0047] 1. Preparation of transgenic TaNRT2.5 plants

[0048] (1) Acquisition of TaNRT2.5 gene

[0049] 1. The total RNA of wheat variety Longchun 23 was extracted, and its genome cDNA was obtained by reverse transcription.

[0050] 2. Using the cDNA obtained in step 1 as a template, use the following primers as primers to carry out PCR amplification to construct the required sequence for overexpressing TaNRT2.5-3B transgenic line wheat:

[0051] TaNRT2.5-OE-F: 5'- GGATCC ATGGAGGGGGAGTCGAAGCC-3' (the underlined sequence is the recognition site for BamHI digestion);

[0052] TaNRT2.5-OE-R: 5'- GGTACC TCAATGGTGATGGTGATGATGCACGTCGGCCGG CGACC-3' (the sequence indicated by the underline is the recognition site for KpnI enzyme digestion).

[0053] PCR system (40μl): template cDNA 4μl, KOD plus DNA polymerase 1μl, 10×PCR buffer forKOD plus 4μl, dNTPs (2mM each) 4μl, 25mM MgSO 4 2 μl, 20 mM each of the upstre...

Embodiment 2

[0088] Embodiment 2, root phenotype identification of TaNRT2.5 transgenic wheat

[0089] Tested wheat: two T3 generation TaNRT2.5-3B overexpressed wheat OE102-6 and OE103-1, wild-type wheat Longchun 23, and no-carrying control plants.

[0090] Root phenotype identification was carried out under hydroponic conditions, and the specific steps were as follows:

[0091] The seeds of each test wheat were germinated in an incubator at 23°C (tap water culture) for 7 days, and after the embryos were removed, they were transferred to high-nitrogen nutrient solution (2mM nitrogen) or low-nitrogen nutrient solution (0.1mM nitrogen) for cultivation. The formula is detailed in Table 1 below. After cultivating for 14 days, the aboveground part was separated from the root system, the fresh weight of the root system of a single plant was weighed, and the total lateral root length and the number of visible lateral roots were analyzed with the WinRHIZO root system scanning system.

[0092] Tab...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of a protein TaNRT2.5 in regulation of plant root development. The invention provides the application of the TaNRT2.5 protein or related biological materials thereof in regulation of plant root development. The related biological materials are nucleic acid molecules capable of expressing the protein TaNRT2.5 or an expression cassette containing the nucleic acid molecules, a recombinant vector, recombinant bacteria or a transgenic cell line. The protein TaNRT2.5 provided by the invention is capable of promoting the plant root development; compared with awild plant, the transgenic plant over-expressing TaNRT2.5-3B has the advantage that the total lateral root length, number of visible lateral roots and root biomass are obviously increased. Therefore,the plant root development can be regulated by utilizing the protein TaNRT2.5. The protein TaNRT2.5 provided by the invention has an important application value on breeding high-yield novel plant materials.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of protein TaNRT2.5 in regulating the development of plant roots. Background technique [0002] The root is an important organ for plant growth and development, and its main functions are absorption, transportation, support, synthesis and storage. Plants absorb water, minerals and other nutrients from the soil through the root system, therefore, the root system is extremely important to the growth and development of plants. There are significant differences between the root systems of monocotyledonous and dicotyledonous plants. Therefore, although great progress has been made in the study of Arabidopsis root development in recent years, the relevant mechanisms of food crops such as wheat are not well understood. [0003] Wheat is the main food crop, but in semi-arid dry farming areas, the lack of water resources has become the main factor limiting the high yield of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/06A01H6/46
CPCC07K14/415C12N15/8261
Inventor 童依平李文静何雪赵学强滕婉马文英
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI