Application of protein TaNRT2.5 in regulation of plant root development
A plant root system, tanrt2.5 technology, applied in the biological field, can solve the problem of not knowing much about the mechanism of food crops, and achieve the effect of promoting the development of plant roots and increasing root biomass
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Embodiment 1, the construction of transgenic TaNRT2.5 wheat
[0047] 1. Preparation of transgenic TaNRT2.5 plants
[0048] (1) Acquisition of TaNRT2.5 gene
[0049] 1. The total RNA of wheat variety Longchun 23 was extracted, and its genome cDNA was obtained by reverse transcription.
[0050] 2. Using the cDNA obtained in step 1 as a template, use the following primers as primers to carry out PCR amplification to construct the required sequence for overexpressing TaNRT2.5-3B transgenic line wheat:
[0051] TaNRT2.5-OE-F: 5'- GGATCC ATGGAGGGGGAGTCGAAGCC-3' (the underlined sequence is the recognition site for BamHI digestion);
[0052] TaNRT2.5-OE-R: 5'- GGTACC TCAATGGTGATGGTGATGATGCACGTCGGCCGG CGACC-3' (the sequence indicated by the underline is the recognition site for KpnI enzyme digestion).
[0053] PCR system (40μl): template cDNA 4μl, KOD plus DNA polymerase 1μl, 10×PCR buffer forKOD plus 4μl, dNTPs (2mM each) 4μl, 25mM MgSO 4 2 μl, 20 mM each of the upstre...
Embodiment 2
[0088] Embodiment 2, root phenotype identification of TaNRT2.5 transgenic wheat
[0089] Tested wheat: two T3 generation TaNRT2.5-3B overexpressed wheat OE102-6 and OE103-1, wild-type wheat Longchun 23, and no-carrying control plants.
[0090] Root phenotype identification was carried out under hydroponic conditions, and the specific steps were as follows:
[0091] The seeds of each test wheat were germinated in an incubator at 23°C (tap water culture) for 7 days, and after the embryos were removed, they were transferred to high-nitrogen nutrient solution (2mM nitrogen) or low-nitrogen nutrient solution (0.1mM nitrogen) for cultivation. The formula is detailed in Table 1 below. After cultivating for 14 days, the aboveground part was separated from the root system, the fresh weight of the root system of a single plant was weighed, and the total lateral root length and the number of visible lateral roots were analyzed with the WinRHIZO root system scanning system.
[0092] Tab...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


