Primer probe group and reagent box for detecting rift valley fever virus with RAA (Recombinase Aided Amplification) fluorescence method
A Rift Valley fever virus, primer probe technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, microbial measurement / inspection, etc., can solve the problems of high false positive rate and high requirements for target genes, and achieve good specificity, The effect of high specificity and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] The present invention extracts Rift Valley fever virus sample RNA for verification, and according to the gene name Rift Valley fever virus (Rift Valley fever virus, RVFV), finds the corresponding full gene sequence (www.ncbi.nlm.nih.gov) in genebank, uses DNASTAR The software performed homology analysis and b1ast sequence analysis, and screened out the highly conserved sequence of Rift Valley fever virus, as shown in SEQ ID NO.4: GTTGATGAGAGCCTCCACAGTTGCTTTGCCTTCTTTCGACATTTTCATCATCATCCTCCGGGGCTTGTTGCCACGAGTCAGAGCCAGAACAATCATTTTCTTGGCATCCTTCTCCCAGTCAGCCCACCATACTGCTTTAAGAGTTCGATAGACCCTACGAGCATCAACCACCTTGATAACCCTACGAGCATCAACCCTT.
[0045] According to the highly conserved sequence as the target gene for detection, the invention synthesizes the recombinant DNA plasmid of Rift Valley fever virus and designs primer probes.
[0046] According to the above sequence, Sangon Bioengineering (Shanghai) Co., Ltd. was entrusted to synthesize the recombinant DNA plasmid of Rift Valley ...
Embodiment 2
[0069] Sensitivity experiment
[0070] Upstream primers:
[0071]5'-CATTTTCATCATCATCCTCCKGGGCTTRTTG-3';
[0072] Downstream primers:
[0073] 5'-GARCTCYTAAAGCAGTATGGTGGGGCTGACT-3'.
[0074] The probe sequence is:
[0075] GGGAGAAGGATGCCAAGAAAATGATTGTTCTGGCTCTRACTCGTG
[0076] The fluorescent reporter group uses FAM, and the fluorescent quencher group uses BHQ1;
[0077] The modified probe is:
[0078] GGGAGAAGGATGCCAAGAAAATGATTGT(BHQ1-dT)(THF)(FAM-dT)GGCTCTRACTCGTG;
[0079] The composition of the kit is shown in Table 1:
[0080] Table 1 Kit composition list
[0081]
[0082] Rift Valley fever virus recombinant DNA plasmid positive standard prepared different concentrations of working standards, respectively:
[0083] Working standard (positive quality control) 1, containing 1.0×10 6 Copies / μL Rift Valley fever virus recombinant DNA plasmid.
[0084] Working standard (positive quality control) 2, containing 1.0×10 5 Copies / μL Rift Valley fever virus recombinant...
Embodiment approach
[0090] 1 Preparation of reaction buffer
[0091] Draw 301 μL of reaction buffer solution from the reaction buffer tube in the kit and add it to the pre-prepared 1.5mL PE tube, then add 16 μL of the mixture of probe and primer (the concentration of the probe is 0.02mmol / L, and the concentration of the primer is 0.05mmol / L ), and mix thoroughly to obtain the mixed reaction buffer.
[0092] 2 RAA fluorescent basic reaction reagent redissolution
[0093] Prepare 7 RAA fluorescent basic reaction reagents, draw 45 μL of the reaction buffer mixed in step 1 and add them to the prepared 7 RAA fluorescent basic reaction reagent tubes, so that the lyophilized powder is fully dissolved and mixed to form an RAA reaction system .
[0094] 3. Sample addition reaction
[0095] Add 5 μL of negative quality control, 5 μL of working standard 6, 5 μL of working standard 5, 5 μL of working standard 4, 5 μL of working standard 3, 5 μL of working standard into the above 7 prepared RAA fluorescent...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com