Base editing tool and application thereof

A base editing and tool technology, applied in the field of gene editing, can solve the problems of insufficient editing efficiency, small editing window, and low recognition efficiency, and achieve a large base editing range, high base editing accuracy, and editing efficiency low effect

Active Publication Date: 2018-10-30
SHANGHAI TECH UNIV
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing base editing tools generally cannot edit more sites of interest due to the small editing window and the limitation of PAM sequences
Although the coverage can be improved by modifying SpCas9 to recognize different PAMs, compared with the specific recognition of the PAM sequence NGG by wild-type SpCas9, the recognition efficiency of the modified version of SpCas9-BE3 to other PAMs is still low, resulting in the loss of Editing efficiency is not efficient enough

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Base editing tool and application thereof
  • Base editing tool and application thereof
  • Base editing tool and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] 1. Construction of BE-PLUS system plasmid

[0057] 10 copies of the GCN4 sequence (10XGCN4) were synthesized by Jinweizhi Biotechnology Co., Ltd., cloned into the pUC57 vector to obtain the pUC57-10XGCN4 vector, and diluted to 10 μM as a PCR template. The forward primer was designed with NheI restriction site GCTGGCTAGCACCATGGGACCCAAGAAAAAACGCAAGGTGGAAG, and the reverse primer was designed with XbaI restriction site GTCTCTAGACACCTTGCGCTTCTTCTTGGGTCC, dissolved in water to 10 μM. A 10X GCN4 sequence fragment was amplified using Novizan High Fidelity Enzyme Kit (Vazyme, p501-d2). The amplification system and PCR reaction conditions are as follows:

[0058]

[0059]

[0060] The PCR amplification product was purified and recovered by AxyPrep PCR Clean-up Kit (Axygen, AP-PCR-500G), and 1 μg was taken, digested with NheI (NEB, R0131S) and XbaI (NEB, R0145S), and incubated at 37°C for 2h . Another 1 μg of pST1374-N-NLS-flag-linker-Cas9-D10A (Addgene #51130) vector wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a base editing tool and application thereof. The base editing tool is characterized by comprising GCN4-D10A, a scFv-APOBEC-UGI vector or a scFv-APOBEC-UGI-GB1 vector, and sgRNAat target specific sites, wherein the GCN4-D10A is formed by connecting multi-copied GCN4 to D10A-Cas9; the scFv-APOBEC-UGI vector is formed by connecting cytosine deaminase APOBEC and uracil glycosylase inhibitors UGI to a single-chain antibody scFv; the scFv-APOBEC-UGI-GB1 vector is formed by connecting the cytosine deaminase APOBEC and uracil glycosylase inhibitors UGI and a thermal stability domain GB1 for preventing multimerization to the single-chain antibody scFv. Compared with a commonly used base editing tool, the base editing tool disclosed by the invention has the advantages that the base editing windows are obviously increased, and the application range of base editing in genome is further widened.

Description

technical field [0001] The invention relates to a novel base editing tool, which belongs to the field of gene editing, and more specifically relates to a tool for specific base replacement based on the combination of a CRISPR system and a base deaminase. Background technique [0002] Gene editing is a technical means to achieve gene knockout or insertion of foreign DNA fragments by introducing sequence changes at specific sites on DNA. At present, there are mainly three kinds of programmable nucleases, the early zinc finger ribonuclease (ZFN) system, the transcription activator-like effector nuclease (TALEN) system and the now commonly used CRISPR-Cas9 system. 1 . The CRISPR-Cas9 gene editing system is easy to operate, and only needs to change the target sequence of sgRNA to perform gene editing at the new target site, so it is rapidly and widely used in gene function research, disease modeling at the cell or animal level, and Gene therapy 2-7 . [0003] In the process o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85
CPCC12N15/85C12N2810/10
Inventor冯松杰江雯黄行许
OwnerSHANGHAI TECH UNIV