Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for obtaining rice mutant with lost genetic intervention and application thereof

A mutant and rice technology, applied in the biological field, can solve the problems of complex rice hybrid breeding operations, speed up the replacement of rice chromosome segments, etc., and achieve the effects of improving breeding efficiency, simplifying the breeding process, and speeding up the exchange

Active Publication Date: 2018-11-02
CHINA NAT RICE RES INST
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The present invention aims to provide a method for obtaining a rice mutant that has lost genetic interference and its application, so as to solve the technical problem of complex rice hybrid breeding operations in the prior art and to speed up the replacement of rice chromosome segments

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining rice mutant with lost genetic intervention and application thereof
  • Method for obtaining rice mutant with lost genetic intervention and application thereof
  • Method for obtaining rice mutant with lost genetic intervention and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0023] According to a typical embodiment of the present invention, gene editing tools such as CRISPR-Cas9, ZFN, TALEN or CRISPR-cpf1 are used to prevent the expression of the first 350 amino acids of the ZEP1 protein or to lose protein activity / function. Preferably, the CRISPR-Cas9 technology is selected, which is relatively mature and easy to operate. In addition, RNAi and other methods can also be used to interfere with the expression of ZEP1 protein to achieve the above purpose. Methods of inhibiting protein expression or inhibiting protein activity other than RNA interference, such as protein modification after expression, can achieve the same effect.

[0024] According to a typical embodiment of the present invention, the first 350 amino acids of the ZEP1 protein are not expressed or the activity / function of the protein is lost by means of frameshift mutation. Preferably, CRISPR-Cas9 is used to edit the rice synaptonemal complex gene ZEP1, the editing site is located at t...

Embodiment 1

[0028] The specific operation steps are as follows:

[0029] 1. Construction of gene knockout vector

[0030] According to the requirements of the CRISPR-Cas9 system for the target sequence (PAM (Protospacer Adjacent Motif) is NGG, and the sequence length is 22 bp), a specific target sequence was selected on the ZEP1 gene sequence, and according to the gRNA primer design principle, the F direction primer and the R Add enzyme-cleaved junction bases to both ends of the primers, and the designed primers are named ZEP1-gRNA-F / ZEP1-gRNA-R.

[0031] ZEP1-gRNA-F has the following sequence: SEQ ID NO: 1 (ggcatcggggcttaggggtctcga);

[0032] ZEP1-gRNA-R has the following sequence: SEQ ID NO: 2 (aaactcgagacccctaagccccga).

[0033] The designed ZEP1-gRNA-F / ZEP1-gRNA-R primers were annealed at 100°C for 5 minutes, cooled naturally, and the annealed product was ligated with the intermediate carrier Sk-gRNA that had been digested with Aar I to obtain the ligated product. The ligated produ...

Embodiment 2

[0051] The specific operation steps are as follows:

[0052] 1. Construction of RNA interference recombinant vector

[0053] A 159bp fragment was amplified by using the reverse-transcribed cDNA of rice panicle total RNA as a template and using ZEP1-RNAi-F / ZEP1-RNAi-R as primers. ZEP1-RNAi-F (SEQ ID NO: 4): 5'-ACG GTC GAC GCTTAGTGGTTTTACGGTTAAGG-3' (the underline is the Sal I restriction site), ZEP1-RNAi-R (SEQ ID NO: 5): 5'-CGC GGATCC TGTTCAAATTTGTCC TTGGCAG-3' (the underline is the restriction site of BamH I).

[0054] The amplified sequence is (SEQ ID NO: 6):

[0055] GCTTAGTGGTTTTACGGTTAAGGTAACTGAGCTAGATAAAGAGCACACATCAATTTCAAGTCATGTCACTCAGTTGATTTCTTCATTTGAGAGATATGATGGAAAGGTTCACGAGGAAAAAATGTTGATGATAAAATCTGCCAAGGACAAATTTGAACA

[0056] The fragment was digested with BamHI and SalI, recovered, and ligated with the vector pUCCRNAi that had undergone the same digestion to obtain intermediate vector 1.

[0057] The recovered fragment was ligated with intermediate vector 1 d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for obtaining a rice mutant with lost genetic intervention and application thereof. The method comprises the following steps: enabling the first 350 amino acids of a ZEP1 protein to not express or to lose protein activity / function by adopting genetic engineering means. According to the technical scheme disclosed by the invention, ZEP1 genes of rice are modified, the modified plants are male sterile and female fertile, and the modified rice plants can be used for crossbreeding. Since the modified rice cell nucleus is sterile, when the modified rice is used for breeding, a matched maintainer line is not needed; and since genetic intervention of the modified rice is lost, the rice can serve as an intermediate material for breeding, exchange of chromosome segments is accelerated, and the breeding efficiency is improved.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for obtaining a rice mutant that loses genetic interference and its application. Background technique [0002] In 1916, when Muller was studying the genetic laws of Drosophila, he found that an exchange on a chromosome reduced the probability of another exchange in an adjacent interval. This phenomenon was named genetic interference by him. After more than 100 years of research, it has been found that, except for a few organisms such as fission yeast and blue-green algae, the phenomenon of genetic interference generally exists in eukaryotes. Due to the existence of genetic interference, the physical distance of double crossover on chromosomes is usually relatively large, and the genes on the same chromosome tend to be linked to inheritance, and the exchange of genetic material of chromosomes is therefore strictly controlled. low frequency. If a mutant with a loss of geneti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/46
CPCC12N15/8213C12N15/8289
Inventor 王克剑华宇峰刘庆王春
Owner CHINA NAT RICE RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com