Vaccine for preventing dog Toxoplasma gondii infection and preparation method of vaccine

A technology for toxoplasmosis and prevention of dogs, applied in the fields of immunology and biology, can solve the problems of vaccines and drugs for canine toxoplasmosis

Active Publication Date: 2018-11-16
HAIMU ANIMAL HEALTH PROD (SHANDONG) CO LTD
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, so far, there are still no ideal commercial vaccines and drugs for the prevention and treatment of canine toxoplasmosis at home and abroad. Toxoplasma infection can cause host protective immune responses. Therefore, the development of safe and effective vaccines should be a good preventive measure for toxoplasmosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine for preventing dog Toxoplasma gondii infection and preparation method of vaccine
  • Vaccine for preventing dog Toxoplasma gondii infection and preparation method of vaccine
  • Vaccine for preventing dog Toxoplasma gondii infection and preparation method of vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Embodiment 1: Construction of the prokaryotic expression vector of Toxoplasma gondii recombinant cyclophilin mutant protein

[0061] The gene is artificially synthesized according to the nucleic acid sequence SEQ ID NO.1, and primers are designed according to the physical map of the prokaryotic expression vector pET28a and restriction sites are introduced.

[0062] Upstream primer: ATGGAATTC ATGGAAAACGCGGGCGTGCGCAAA

[0063] Downstream primer: AAGCTT TTCTTTTTTGCCAATATCGGTAA

[0064] Synthesize the gene sequence of SEQ ID NO.1 by artificial synthesis method, use the above primers to amplify in large quantities, and clone the PCR purified product into pMD-18-T. The positive clones are identified by enzyme digestion and sequencing, and the positive plasmids are detected by EcoRI and Hind III The purified target fragment after double enzyme digestion was connected to the prokaryotic expression vector pET28a, the ligation product was transformed into E.coli DH5α competent c...

Embodiment 2

[0065] Embodiment 2: Purification of expressed protein

[0066] (1) Extraction and solubility verification of expressed protein

[0067] A single colony of E.coli BL21(DE3) transformed with the recombinant plasmid pET-28a(+)-C18 was inoculated in 5mL LB liquid medium and cultured overnight at 37°C with shaking. The next day, the seed liquid was transferred to 800mL LB liquid medium for propagation at 37°C, and the expression was induced under the optimal conditions when the OD600 of the bacterial liquid was monitored to 0.6-0.7. The bacteria were collected by centrifugation, suspended in 20mL PBS, frozen and thawed 5 times (-80°C, 1h / 37°C, 10min), after sonication, the supernatant was centrifuged to obtain the soluble protein (active protein). Suspend the precipitate with 10 mL of denaturing buffer, shake at room temperature for 1 h, and centrifuge to obtain the supernatant, which is the insoluble protein (denatured protein). The above two proteins were tested by SDS-PAGE to...

Embodiment 3

[0070] Example 3: Detection of the immunogenicity of expression products to mouse macrophages

[0071] RAW264.7 cells were seeded on 24-well culture plates at 0.5×106 / mL, 0.5 mL per well, 5% CO2, and cultured at 37°C for 24 hours. After aspirating the supernatant, dissolve the prepared Toxoplasma gondii recombinant cyclophilin mutant protein in RAW264.7 cell culture medium, and add 0.5 mL / well to 24 In the well plate, an equal volume of PBS was used as a negative control. The cell culture plate was placed in 5% CO2, cultured in a 37° C. incubator for 48 hours, the supernatant was collected, and the level of TNF-a was detected by ELISA experiment. The results show that the production of TNF-a increases with the increase of protein concentration, ranging from 40pg-310pg, the results are shown in the appendix Figure 5 . It shows that the recombinant cyclophilin mutant protein of Toxoplasma gondii can stimulate RAW264.7 cells to produce TNF-a.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention provides protein with Toxoplasma gondii immunogenicity. The protein is cyclophilin mutant protein and consists of the amino acid sequence shown in SEQ ID 2. The invention further provides nucleic acid capable of encoding the protein with Toxoplasma gondii immunogenicity and consists of the nucleic acid sequence shown in SEQ ID 1. The invention also provides a vaccine. A Toxoplasma gondii antigen gene is subjected to double enzyme digestion, then linked to prokaryotic expression vectors such as pET28a and the like and transformed into prokaryotic expression engineering bacteria such as BL21 (DE3) and the like to be induced to be highly expressed, protein obtained after purification is soluble protein, and the specific immunogenicity of the protein is maintained. The sequence of the cyclophilin protein is optimized, so that the expression amount of the cyclophilin protein in prokaryotic Escherichia coli is remarkably increased. The vaccine can be prepared by engineering strains by adding vaccine adjuvants, unique immunogenicity of the vaccine is maintained, and the vaccine is suitable for industrial production.

Description

technical field [0001] The invention relates to the fields of immunology and biology, and relates to a vaccine for preventing canine toxoplasma infection and a preparation method, in particular to the application of the vaccine in the prevention of canine toxoplasmosis infection. Background technique [0002] Toxoplasmosis is a multi-host protozoan disease that is parasitic in the cells of animals or humans caused by Toxoplasma gondii (Toxoplasmagondii) of the sporozoa class and the genus Toxoplasma. For zoonotic parasitic diseases, felines are the final hosts, and humans and various animals are intermediate hosts. Toxoplasmosis has become one of the important public health problems to be solved urgently in our country, and its reason is mainly reflected in the following points: (1) human toxoplasma infection rate is extremely high, is generally 20%~50%, especially women and children, The infection rate is higher, about 1 / 3 of the people in the world are infected with Toxop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/45C12N15/30C12N15/70C12N1/21A61K39/002A61P33/02C12R1/19
CPCA61K39/002A61P33/02C07K14/45A61K2039/552A61K2039/55566A61K2039/521C07K2319/00
Inventor侯峰曹利利宫鹏涛李思明陈星远丁鹤王典
OwnerHAIMU ANIMAL HEALTH PROD (SHANDONG) CO LTD