Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of transport assistance factor GmPHF1b of phosphate transporter

A technology of transporter and phosphate, applied in application, genetic engineering, plant genetic improvement, etc., to achieve the effect of increasing plant biomass and yield

Inactive Publication Date: 2018-11-20
FUJIAN AGRI & FORESTRY UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Whether a similar regulatory mechanism exists in legumes has not yet been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of transport assistance factor GmPHF1b of phosphate transporter
  • Application of transport assistance factor GmPHF1b of phosphate transporter
  • Application of transport assistance factor GmPHF1b of phosphate transporter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Phylogenetic tree analysis of embodiment 1, PHF1

[0031] Multiple sequence alignment of PHF1 protein

[0032] According to the sequence information of Arabidopsis thaliana and rice PHF1 gene, the candidate gene was screened by Blast in the soybean genome database Phytozome (http: / / www.phytozome.net / soybean), and the obtained gene sequence was carried out in the Arabidopsis thaliana database (TAIR) Blast was used to determine their possible functions, and Phytozome provided information about genes to determine their chromosomal location, and named them according to the Arabidopsis nomenclature (Bucher, 2007). The amino acid sequence of soybean PHF protein was compared with the amino acid sequence of Arabidopsis thaliana and rice PHF1 protein using GENEDOC software for multiple sequence alignment.

[0033] In the published soybean genome database, through homologous comparison, it is predicted that the soybean PHF1 phosphorus transporter family has two members, named Gm...

Embodiment 2

[0035] Embodiment 2, GmPHF1b gene expression pattern

[0036]The nutrient solution cultivation method was adopted for planting. One week after the seedlings were raised, the seedlings with uniform growth were selected and soaked in fresh rhizobia bacteria solution for 30 minutes, and then the seedlings were transferred into the bread boxes with different nutrient solutions. The experiment was a single factor, including two phosphorus levels: low phosphorus (LP: 5 μmol / L) and normal phosphorus (HP: 250 μmol / L); all were low nitrogen (100 μmol / L) and inoculated with rhizobia. 4 repetitions. Leaves, stems, root tips, roots, nodules, and flowers were harvested 55 days after transplanting; samples were stored at -80°C for RNA extraction. soybean PHF1a Gene quantitative PCR primer sequences are:

[0037] GmPHF1b-F: TGGGTCGTGGATTCGGAGGC;

[0038] GmPHF1b-R: CCCCACTTGGGTGGACTGCAA;

[0039] The quantitative PCR procedure was as follows: the cDNA obtained by reverse transcription...

Embodiment 3

[0043] Example 3. Subcellular localization of GmPHF1b

[0044] 1 Vector construction

[0045] according to GmPHF1b Design primers from the full-length cDNA sequence, and add the upstream and downstream primers of the vector respectively Bam HI restriction site, primers are as follows:

[0046] PHF1b-F: GTggatccATGGGGAATGATGCAGGGTC;

[0047] PHF1b-R: GTggatccTCagTCACATATCTACTGGCCCCCAA;

[0048] Using the cDNA of wild-type soybean root as a template, it was amplified by Ex Taq (TAKALA, Japan). GmPHF1b Gene fragment, the PCR product was recovered and then linked to the pBI121-GFP vector digested with the corresponding enzyme, and the clone was picked, detected and sequenced, and the correctly fused clone was saved for future use. After obtaining the desired recombinant vector, the plasmid was transformed into Agrobacterium GV3101 competent cells, and the bacteria were shaken for later use.

[0049] 2 Tobacco transformation

[0050] The GV3101 positive clones containing ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a transport assistance factor GmPHF1b of a phosphate transporter, and particularly relates to application of a GmPHF1b gene in promotion of obtaining of phosphorus by leguminous plants so as to promote nodulation and nitrogen fixation and in cooperation of nitrogen and phosphorus to achieve collaborative efficiency. Homologous comparison clones a gene GmPHF1bexpressed in a leaf, a stem, a root, a root nodule and a flower and verifies that a protein encoded by the gene GmPHF1b cooperates with a phosphate transporter GmPT5 / GmPT7 for controlling obtaining ofnodule phosphorus; overexpression of GmPHF1b obviously increases the number of root nodules of soybeans and the weight of the root nodules and improves the activity of the nitrogenase of the root nodules, so that the contents and the biomasses of nitrogen and phosphorus are increased, and the yield of the soybeans is finally increased.

Description

technical field [0001] The present invention relates to the application of genes, in particular to transport assisting factors of phosphate transporters GmPHF1b The application belongs to the field of biotechnology. Background technique [0002] Soybean (Glycine max) originated in China and is an important grain and oil crop worldwide (Palander et al., 2005). my country's demand for soybeans is increasing day by day, and China has become the world's largest importer of soybeans, and its dependence on soybeans has reached 87%. Therefore, it is imminent to solve the contradiction between supply and demand of soybean production in my country by increasing soybean production. In tropical and subtropical regions, due to the perennial high temperature and rainy conditions, the soil is not only severely acidified, but also the availability of nitrogen and phosphorus in most soils is low, which has become the main factor limiting agricultural production in this region. Nitrogen i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H6/82A01H6/54
CPCC07K14/415C12N15/8243
Inventor 廖红陈丽玉李欣欣
Owner FUJIAN AGRI & FORESTRY UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More