Check patentability & draft patents in minutes with Patsnap Eureka AI!

Construction method of blood platelet nucleic acid library for gene detection and kit

A nucleic acid library and construction method technology, applied in the field of platelet nucleic acid library construction methods and kits for gene detection, can solve problems such as limited application scope and difficulty in meeting clinical needs, and achieve correct misinformation, improve sample detection throughput, reduce The effect of experimental workload

Pending Publication Date: 2018-12-07
XIAMEN LIFEINT TECH CO LTD
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this patent only detects the expression of long-chain non-coding RNA MAGI2-AS3 and ZFAS1 in platelets, which has a limited scope of application and can only be used for the diagnosis of non-small cell lung cancer, which is difficult to meet clinical needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of blood platelet nucleic acid library for gene detection and kit
  • Construction method of blood platelet nucleic acid library for gene detection and kit
  • Construction method of blood platelet nucleic acid library for gene detection and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Preparation of nucleic acid capture probes carrying molecular labels

[0044] The nucleic acid capture probe carrying the molecular label contains the following elements from the 5' end to the 3' end:

[0045] The 5' terminal biotin is modified, streptavidin and biotin have a very high affinity, and the biotin at the 5' end of the superparamagnetic bead affinity probe covalently bound to streptavidin can be used to capture the probe Needle;

[0046] The amplification primer sequence P1, as shown in SEQ ID NO: 1, is used to amplify the full-length cDNA, and the specific sequence is as follows: TAGCAGTCGATTCAACGCAGACATC;

[0047] The sequencing adapter sequence P5, as shown in SEQ ID NO: 2, is used for the 5' end in the construction of the platelet nucleic acid library, and the specific sequence is as follows: CTCTTATACACATCTGACGCTGCCGACGA;

[0048] The sample label sequence is composed of 3 nucleotides (A, G, C, T) randomly, forming 64 different combinations,...

Embodiment 2

[0054] The construction method of embodiment 2 platelet nucleic acid library

[0055] 1. Whole Blood Collection

[0056] Use BD dipotassium EDTA blood collection tubes to collect 2mL of venous blood from the subject. After collection, gently invert the blood collection tube several times to fully mix the anticoagulant with the whole blood. The whole blood should be processed within 96 hours after collection.

[0057] 2. Isolation of Ultrapure Platelets

[0058] The first centrifugation: place the blood collection tube in the centrifuge rotor, centrifuge at 800g for 5 minutes at room temperature, use a pipette to absorb 600 μL of platelet-rich plasma in the upper layer, and transfer it to a new 1.5mL centrifuge tube. Agitation of the middle buffy coat causes leukocytes to float up and the contamination rate increases.

[0059] Magnetic beads pre-treatment: CD45 immunomagnetic beads (Invitrogen, 11153D) and CD235a immunomagnetic beads (Lifeint, A5005M) were vortexed before use...

Embodiment 3

[0076] Example 3 Sequencing of platelet nucleic acid library and acquisition of gene expression level data

[0077] Use Illumina's HiSeq X series sequencer, adopt the PE150 strategy for high-throughput sequencing, use the 30 sample tags described in step 3 of Example 2, split the off-machine data, use trimmomatic for quality control, and use STAR Compare and annotate with the reference genome whose version number is .GRCh37.75, and finally use featureCounts for gene expression statistics, and use tools such as awk, grep, and sort in the shell scripting language to format the data, and the final data format is 57735 genes and their corresponding expression levels.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a construction method of a blood platelet nucleic acid library for gene detection and a kit. A nucleic acid capturing probe comprises 5' end biotin modification, an amplification primer sequence P1, a sequencing connector sequence P5, a sample label sequence, a single-molecule label sequence and an Oligo (dT) sequence in sequence from 5'. The invention further provides thekit comprising the nucleic acid capturing probe and the construction method for the blood platelet nucleic acid library by utilizing the nucleic acid capturing probe. According to the construction method disclosed by the invention, the starting amount of blood platelets is greatly reduced, the blood platelets can be separated from less whole blood, and trace amplification and library constructionare directly carried out, so that requirements of liquid biopsy are met. Moreover, samples of different examinees can be mixed in the same reaction system, so that the flux of detection is improved; and the construction method and the kit have important clinical significance and practical value.

Description

technical field [0001] The invention relates to the field of sequencing, in particular to a method and a kit for constructing a platelet nucleic acid library for gene detection. Background technique [0002] Early diagnosis of cancer means early treatment, which is extremely critical to the prognosis and survival of patients, and is the best way to improve the survival rate of cancer. Taking lung cancer as an example, lung cancer is the tumor with the highest morbidity and mortality rate in China and even in the world. The late stage of diagnosis is an important reason affecting the prognosis of lung cancer. Early lung cancer can achieve better prognosis through multidisciplinary comprehensive treatment, and even To achieve the purpose of healing. At present, lung cancer is mainly screened by low-dose spiral CT, chest enhanced CT, upper abdominal enhanced CT (or B-ultrasound), head enhanced MR (or enhanced CT), and whole body bone scan for diagnosis and staging. If the CT ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6806C12Q1/6869C12N15/11C12N15/10C40B50/06G06F19/18G06F19/28
CPCC12N15/1096C12Q1/6806C12Q1/6869C40B50/06C12Q2521/107C12Q2531/113C12Q2525/191C12Q2535/122
Inventor 肖剑萍叶国栋许剑雄陈茂立韩大雄郭奇伟蔡逸民杨燕燕李顺杰董康梅朱莎莎张丽芳宋丹
Owner XIAMEN LIFEINT TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More