Construction method of blood platelet nucleic acid library for gene detection and kit
A nucleic acid library and construction method technology, applied in the field of platelet nucleic acid library construction methods and kits for gene detection, can solve problems such as limited application scope and difficulty in meeting clinical needs, and achieve correct misinformation, improve sample detection throughput, reduce The effect of experimental workload
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Preparation of nucleic acid capture probes carrying molecular labels
[0044] The nucleic acid capture probe carrying the molecular label contains the following elements from the 5' end to the 3' end:
[0045] The 5' terminal biotin is modified, streptavidin and biotin have a very high affinity, and the biotin at the 5' end of the superparamagnetic bead affinity probe covalently bound to streptavidin can be used to capture the probe Needle;
[0046] The amplification primer sequence P1, as shown in SEQ ID NO: 1, is used to amplify the full-length cDNA, and the specific sequence is as follows: TAGCAGTCGATTCAACGCAGACATC;
[0047] The sequencing adapter sequence P5, as shown in SEQ ID NO: 2, is used for the 5' end in the construction of the platelet nucleic acid library, and the specific sequence is as follows: CTCTTATACACATCTGACGCTGCCGACGA;
[0048] The sample label sequence is composed of 3 nucleotides (A, G, C, T) randomly, forming 64 different combinations,...
Embodiment 2
[0054] The construction method of embodiment 2 platelet nucleic acid library
[0055] 1. Whole Blood Collection
[0056] Use BD dipotassium EDTA blood collection tubes to collect 2mL of venous blood from the subject. After collection, gently invert the blood collection tube several times to fully mix the anticoagulant with the whole blood. The whole blood should be processed within 96 hours after collection.
[0057] 2. Isolation of Ultrapure Platelets
[0058] The first centrifugation: place the blood collection tube in the centrifuge rotor, centrifuge at 800g for 5 minutes at room temperature, use a pipette to absorb 600 μL of platelet-rich plasma in the upper layer, and transfer it to a new 1.5mL centrifuge tube. Agitation of the middle buffy coat causes leukocytes to float up and the contamination rate increases.
[0059] Magnetic beads pre-treatment: CD45 immunomagnetic beads (Invitrogen, 11153D) and CD235a immunomagnetic beads (Lifeint, A5005M) were vortexed before use...
Embodiment 3
[0076] Example 3 Sequencing of platelet nucleic acid library and acquisition of gene expression level data
[0077] Use Illumina's HiSeq X series sequencer, adopt the PE150 strategy for high-throughput sequencing, use the 30 sample tags described in step 3 of Example 2, split the off-machine data, use trimmomatic for quality control, and use STAR Compare and annotate with the reference genome whose version number is .GRCh37.75, and finally use featureCounts for gene expression statistics, and use tools such as awk, grep, and sort in the shell scripting language to format the data, and the final data format is 57735 genes and their corresponding expression levels.
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com