Check patentability & draft patents in minutes with Patsnap Eureka AI!

Goat testis fibroblast membrane system yeast cDNA library and construction method thereof

A technology of fibroblasts and sheep testis, applied in the field of yeast cDNA library and construction of sheep testis fibroblast membrane system, can solve the problem of not very obvious cell lesions

Active Publication Date: 2018-12-14
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Some researchers found that there are many kinds of primary cells and cell lines that can be used to isolate and culture ORFV. In 1957, orf virus successfully replicated the virus on primary cells of sheep embryos, but the cytopathic changes were not very obvious.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Goat testis fibroblast membrane system yeast cDNA library and construction method thereof
  • Goat testis fibroblast membrane system yeast cDNA library and construction method thereof
  • Goat testis fibroblast membrane system yeast cDNA library and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Preparation of Yeast cDNA Library of Sheep Testis Fibroblast Cell Membrane System

[0034] 1.1 Materials and methods

[0035] 1.1.1 Experimental animals

[0036] Gansu Nongshi Ranch Co., Ltd. provided 3 newborn lambs

[0037] 1.1.2 Reagents

[0038] Unless otherwise specified, the reagents or medicines involved in the present invention are all commercially available, wherein the library construction easy-cloning homogenized cDNA library construction kit and related reagents are from Dualsystem Biotech, and restriction endonucleases are purchased from NEB Company, Plasmids were purchased from QIAquick, pPR3-N, pBT3-N, pBT3-STE, pTSu2-APP and pNubG-Fe65 vectors, NMY51 were purchased from Dualsystem Biotech, SD agar medium, SD medium, -trp SDO, -leu / trpDDO, -his / -leu / -trp TDO, -ade / -his / -leu / -trp QDO, SD-his / -leu / -trp, SD-ade / -his / -leu / -trp solid media The above was purchased from Clontech Company. Co-immunoprecipitation-related kits were purchased from The...

Embodiment 2

[0080] Example 2: Screening of Yeast cDNA Library of Sheep Testis Fibroblast Membrane System

[0081] 2.1.1 Construction of bait carrier

[0082] Using the designed primer pBT3-N-ORF047-upstream (SEQ ID NO1):

[0083] 5'ATTAACAAGGCCATTACGGCCGGGGCCGCCGCCAGCATCCAGACCACC 3',

[0084] pBT3-N-ORF047-downstream (SEQ ID NO2):

[0085] 5'-GACGGACGGCGGAAATTCCGTAAAGGGGCCGCCTCGGCCATCAGTT 3', using PCR from the pGEM-ORF-047 constructed in our laboratory (Chen Guohua et al., Analysis of gene expression and protein localization of sheep infectious impetigo virus ORF047 in cells, Zoonoses in China Acta Sinica, 2018.2, 34(2): 67~70) plasmid amplifies the target product ORF-O47 gene (ORF-O47 gene sequence SEQ ID NO3), recovers the amplified fragment with a DNA recovery kit, and uses it with the pBT3-N plasmid Restriction endonuclease SfiI digestion, T4 DNA ligase ligation, target fragments were cloned into pBT3-N bait vector, transformed into DH5α, positive clones were selected and sequence...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method for a goat testis fibroblast membrane system yeast cDNA library. The preparation method comprises the following steps: preparation of goat testis fibroblasts; extraction of RNAs of the goat testis fibroblasts; synthesis of cDNAS and homogenization of a cDNA library; linkage of the cDNAS with a pPR3-N vector, transformation of the host cell DH5alphja witha linkage product so as to obtain the goat testis fibroblast membrane system yeast cDNA library, and cloning and verification; screening of the goat testis fibroblast membrane system yeast cDNA library; etc. The goat testis fibroblast membrane system yeast cDNA library prepared in the invention has a cDNA storage capacity of 7.5*10<5>; fragments have sizes in a range of 200 to 2000 bp and an average length of 1000 bp; and the recombination rate of the library is 100%. The screening of the goat testis fibroblast membrane system yeast cDNA library with the membrane protein of Orf viruses provesthat the library is a high-quality library.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a yeast cDNA library of sheep testis fibroblast membrane system and its construction method and application. Background technique [0002] Orf, also known as sheep contagious pustular or sheep contagious pustular dermatitis, is a highly contagious zoonotic disease caused by orf virus ORFV. ORFV is one of the representatives of Poxviridae and Parapoxvirus; the virus particles are oval, 250-280nm long and 170-200nm wide; it causes a viral infectious disease of sheep and can also infect people. The performance of sheep infected with aphthous oral ulcer virus is reduced, it is difficult to eat food, it becomes thin and carries the virus for a long time, which brings serious harm to the sheep industry and the health of the breeders. The disease has spread to almost all sheep-raising countries and regions in the world, and my country is a country where the disease is highly p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10C40B50/06C40B40/08
CPCC12N15/1096C40B40/08C40B50/06
Inventor 陈国华景志忠贾怀杰何小兵房永祥宋世斌
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More