Yeast cDNA library and construction method of a sheep testis fibroblast membrane system
A fibroblast and sheep testis technology is applied in the field of yeast cDNA library of sheep testicular fibroblast membrane system and its construction, which can solve the problem that cytopathic changes are not very obvious.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Preparation of Yeast cDNA Library of Sheep Testis Fibroblast Cell Membrane System
[0034] 1.1 Materials and methods
[0035] 1.1.1 Experimental animals
[0036] Gansu Nongshi Ranch Co., Ltd. provided 3 newborn lambs
[0037] 1.1.2 Reagents
[0038] Unless otherwise specified, the reagents or medicines involved in the present invention are all commercially available, wherein the library construction easy-cloning homogenized cDNA library construction kit and related reagents are from Dualsystem Biotech, and restriction endonucleases are purchased from NEB Company, Plasmids were purchased from QIAquick, pPR3-N, pBT3-N, pBT3-STE, pTSu2-APP and pNubG-Fe65 vectors, NMY51 were purchased from Dualsystem Biotech, SD agar medium, SD medium, -trp SDO, -leu / trpDDO, -his / -leu / -trp TDO, -ade / -his / -leu / -trp QDO, SD-his / -leu / -trp, SD-ade / -his / -leu / -trp solid media The above was purchased from Clontech Company. Co-immunoprecipitation-related kits were purchased from The...
Embodiment 2
[0080] Example 2: Screening of Yeast cDNA Library of Sheep Testis Fibroblast Membrane System
[0081] 2.1.1 Construction of bait carrier
[0082] Using the designed primer pBT3-N-ORF047-upstream (SEQ ID NO1):
[0083] 5'ATTAACAAGGCCATTACGGCCGGGGCCGCCGCCAGCATCCAGACCACC 3',
[0084] pBT3-N-ORF047-downstream (SEQ ID NO2):
[0085] 5'-GACGGACGGCGGAAATTCCGTAAAGGGGCCGCCTCGGCCATCAGTT 3', using PCR from the pGEM-ORF-047 constructed in our laboratory (Chen Guohua et al., Analysis of gene expression and protein localization of sheep infectious impetigo virus ORF047 in cells, Zoonoses in China Acta Sinica, 2018.2, 34(2): 67~70) plasmid amplifies the target product ORF-O47 gene (ORF-O47 gene sequence SEQ ID NO3), recovers the amplified fragment with a DNA recovery kit, and uses it with the pBT3-N plasmid Restriction endonuclease SfiI digestion, T4 DNA ligase ligation, target fragments were cloned into pBT3-N bait vector, transformed into DH5α, positive clones were selected and sequence...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com