Unlock instant, AI-driven research and patent intelligence for your innovation.

Yeast cDNA library and construction method of a sheep testis fibroblast membrane system

A fibroblast and sheep testis technology is applied in the field of yeast cDNA library of sheep testicular fibroblast membrane system and its construction, which can solve the problem that cytopathic changes are not very obvious.

Active Publication Date: 2021-02-02
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Some researchers found that there are many kinds of primary cells and cell lines that can be used to isolate and culture ORFV. In 1957, orf virus successfully replicated the virus on primary cells of sheep embryos, but the cytopathic changes were not very obvious.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yeast cDNA library and construction method of a sheep testis fibroblast membrane system
  • Yeast cDNA library and construction method of a sheep testis fibroblast membrane system
  • Yeast cDNA library and construction method of a sheep testis fibroblast membrane system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Preparation of Yeast cDNA Library of Sheep Testis Fibroblast Cell Membrane System

[0034] 1.1 Materials and methods

[0035] 1.1.1 Experimental animals

[0036] Gansu Nongshi Ranch Co., Ltd. provided 3 newborn lambs

[0037] 1.1.2 Reagents

[0038] Unless otherwise specified, the reagents or medicines involved in the present invention are all commercially available, wherein the library construction easy-cloning homogenized cDNA library construction kit and related reagents are from Dualsystem Biotech, and restriction endonucleases are purchased from NEB Company, Plasmids were purchased from QIAquick, pPR3-N, pBT3-N, pBT3-STE, pTSu2-APP and pNubG-Fe65 vectors, NMY51 were purchased from Dualsystem Biotech, SD agar medium, SD medium, -trp SDO, -leu / trpDDO, -his / -leu / -trp TDO, -ade / -his / -leu / -trp QDO, SD-his / -leu / -trp, SD-ade / -his / -leu / -trp solid media The above was purchased from Clontech Company. Co-immunoprecipitation-related kits were purchased from The...

Embodiment 2

[0080] Example 2: Screening of Yeast cDNA Library of Sheep Testis Fibroblast Membrane System

[0081] 2.1.1 Construction of bait carrier

[0082] Using the designed primer pBT3-N-ORF047-upstream (SEQ ID NO1):

[0083] 5'ATTAACAAGGCCATTACGGCCGGGGCCGCCGCCAGCATCCAGACCACC 3',

[0084] pBT3-N-ORF047-downstream (SEQ ID NO2):

[0085] 5'-GACGGACGGCGGAAATTCCGTAAAGGGGCCGCCTCGGCCATCAGTT 3', using PCR from the pGEM-ORF-047 constructed in our laboratory (Chen Guohua et al., Analysis of gene expression and protein localization of sheep infectious impetigo virus ORF047 in cells, Zoonoses in China Acta Sinica, 2018.2, 34(2): 67~70) plasmid amplifies the target product ORF-O47 gene (ORF-O47 gene sequence SEQ ID NO3), recovers the amplified fragment with a DNA recovery kit, and uses it with the pBT3-N plasmid Restriction endonuclease SfiI digestion, T4 DNA ligase ligation, target fragments were cloned into pBT3-N bait vector, transformed into DH5α, positive clones were selected and sequence...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing a yeast cDNA library of sheep testis fibroblast membrane system, which comprises preparing sheep testis fibroblasts; extracting RNA from sheep testis fibroblasts; synthesizing cDNA and homogenizing the cDNA library; cDNA and pPR3-N carrier Ligation, transformation of the ligation product into host cell DH5α, obtaining the yeast cDNA library of the sheep testis fibroblast membrane system, and performing cloning verification; screening the yeast cDNA library of the sheep testis fibroblast membrane system. The cDNA library capacity of the present invention is 7.5 × 10 5 , the size of the fragments is 200‑2000bp, the average length is 1000bp, and the recombination rate of the library is 100%. The library was screened by using the membrane protein of aphthus virus, which proved that the library was a high-quality library.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a yeast cDNA library of sheep testis fibroblast membrane system and its construction method and application. Background technique [0002] Orf, also known as sheep contagious pustular or sheep contagious pustular dermatitis, is a highly contagious zoonotic disease caused by orf virus ORFV. ORFV is one of the representatives of Poxviridae and Parapoxvirus; the virus particles are oval, 250-280nm long and 170-200nm wide; it causes a viral infectious disease of sheep and can also infect people. The performance of sheep infected with aphthous oral ulcer virus is reduced, it is difficult to eat food, it becomes thin and carries the virus for a long time, which brings serious harm to the sheep industry and the health of the breeders. The disease has spread to almost all sheep-raising countries and regions in the world, and my country is a country where the disease is highly p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/10C40B50/06C40B40/08
CPCC12N15/1096C40B40/08C40B50/06
Inventor 陈国华景志忠贾怀杰何小兵房永祥宋世斌
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More