A DNA methylation degree quantifying method and application

A methylation and non-methylation technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of limited method application scope and large sample demand, and achieve strong specificity and detection sensitivity. high effect

Inactive Publication Date: 2018-12-18
天津知因生物科技有限公司
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the target gene detected by the method must be rich in methylation-sensitive restriction endonuclease cleavage sites, and this method cannot be used for target genes that do not contain methylation-sensitive restriction endonuclease cleavage sites. The method detects the degree of methylation, which greatly limits the scope of application of the method; in addition, the method needs to divide the sample to be detected into two parts to be processed separately, and the demand for samples is large, so it is not suitable for the methylation detection of trace ctDNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A DNA methylation degree quantifying method and application
  • A DNA methylation degree quantifying method and application
  • A DNA methylation degree quantifying method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Design and preparation of primers and probes for cg10590292

[0060] In this example, specific primers and Taqman probes were designed according to the characteristic DNA sequence of the methylation-sensitive region of the GpC island of cg10590292 and its upstream promoter region, specifically:

[0061] Methylation probe (SEQ ID NO.1):

[0062] 5'- / 6-FAM / TGGGAGAGCGGGAGAT / BHQ1 / -3';

[0063] Unmethylated probe (SEQ ID NO.2):

[0064] 5'- / HEX / TTTGGGAGAGTGGGAGATTT / BHQ1 / -3';

[0065] Upstream primer (SEQ ID NO.3):

[0066] 5'-TGTTAGTTTTTTATGGAAGTTT-3';

[0067] Downstream primer (SEQ ID NO.4):

[0068] 5'-AAACAACAAAATACTCAAA-3'.

Embodiment 2

[0069] Example 2 DNA extraction and sulfite modification

[0070] (1) Take 10mL of blood samples from the subjects, store them in Streck Cell-Free DNA BCT plasma free DNA blood collection tubes, and conduct plasma separation;

[0071] (2) ctDNA in plasma was extracted using ctDNA Extraction Kit (QIAamp Circulating Nucleic Acid Kit);

[0072] (3) Using the DNA sulfite modification kit (EZ DNA Methylation-Direct Kit), strictly follow the operation steps of the manual to treat the extracted ctDNA with sulfite, so that the unmethylated cytosine in the ctDNA is deaminated and transformed into Uracil, while methylated cytosine remains unchanged, yields sulfite-converted ctDNA.

Embodiment 3

[0073] Embodiment 3 digital PCR

[0074] (1) Configure methylated PCR system and unmethylated PCR system respectively, including ctDNA template, primer pair, Taqman probe, DNA polymerase and dNTP, etc. The primer pair and Taqman probe used are shown in Table 1;

[0075] (2) Add 20 μL of sulfite-modified ctDNA samples to each of the 8 wells in the middle row of the DG8cartridge droplet generation card. Add 70 μL micro-droplet generating oil;

[0076] (3) Mix evenly by inverting, centrifuge to remove air bubbles, put into the micro-droplet generator, and generate micro-droplets;

[0077] (4) Transfer the droplet to a 96-well plate, and perform PCR amplification after sealing the film. The amplification conditions are: 95°C, 10min, 1 cycle; 95°C, 30s, 60°C, 60s, 40 cycles; 98°C, 60s, 40 cycles; 10min;

[0078] (5) After assembling the 96-well plate that completed the PCR reaction, put it into the droplet reader smoothly, perform absolute quantification of the DNA in the two PC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A DNA methylation degree quantifying method and application are provided. The method includes (1) adding sulfite modified DNA into a PCR system, and performing digital PCR; and (2) acquiring the DNA methylation degree according to the DNA methylation copy number and non-methylation copy number. The PCR system in the step (1) includes a Taqman probe, with the Taqman probe including a methylation Taqman probe or a non-methylation Taqman probe. The target gene modified with sulfite is detected with the methylation probe and the non-methylation probe separately, and the methylation copy number andthe non-methylation copy number of the gene to be detected are measured by the digital PCR accurately, thus achieving absolute quantification of the methylation degree of the target gene. The methodis suitable for detection of trace ctDNA in blood samples, is high in sensitivity, high in specificity, precise and rapid, and facilitates promotion in the technical field of liquid biopsy.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a quantitative method and application of DNA methylation degree. Background technique [0002] Malignant tumors have become one of the diseases with the highest fatality rate. Although there are many methods for the treatment of tumors, the prognosis of patients is often related to the stage of tumors, and the prognosis of advanced tumors is poor. The World Health Organization (WHO) pointed out that early diagnosis and treatment of tumors will help increase the cure rate to 80%. However, most cancers have no obvious symptoms in the early stage, develop rapidly and easily transfer, and are already in the middle and late stages when they are discovered, and the clinical treatment effect is not good. Early screening methods currently used in clinical practice include detection of serological tumor protein markers or imaging monitoring, but they have the disadvantages of low sensitivity o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6858C12Q1/6851
CPCC12Q1/6851C12Q1/6858C12Q2523/125C12Q2561/101C12Q2537/16C12Q2563/159
Inventor罗敏赵勇娟韩玥斌刘焕
Owner天津知因生物科技有限公司