3alpha-hydroxysteroid dehydrogenase mutant, coding nucleotide sequence and kit

A technology of hydroxysteroids and nucleotide sequences, which is applied in enzymes, genetic engineering, oxidoreductases, etc., can solve the problems of low detection efficiency and catalytic activity of enzymatic methods, so as to improve the detection efficiency of enzymatic methods, reduce production costs, The effect of improving market competitiveness

Active Publication Date: 2018-12-25
SHENZHEN AMTECH BIOENGINEERING LTD INC
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In order to overcome the shortcomings of low catalytic activity of 3α-HSD enzyme in the prior art and low efficiency of corresponding enzymatic detection, the object of the present invention is to provide a 3α-hydroxysteroid dehydrogenase mutant with higher catalytic activity, coding gene and Its application, thereby improving its efficiency as a tool enzyme in enzymatic detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Construction of 3α-HSD-pET22b expression vector

[0019] Primers HSD-F and HSD-R were designed according to the gene sequence of GenBank (GenBank ID: 11140882). Primers are as follows:

[0020] HSD-F: CGCaagcttATGTCCATCATCGTGATAAGC

[0021] HSD-R: ATActcgagtcaatgatgatgatgatgatggaactgtgtcgggc

[0022] Use primer HSD-F and HSD-R to obtain 3α-HSD full-length gene from Comamonas testosteroni genome PCR amplification, its nucleotide sequence is as shown in SEQ ID NO: 1, and corresponding aminoacid sequence is as shown in Shown in SEQ ID NO:2. Among them, the PCR amplification system is 50 μl in total, including: Comamonas testosteroni genome (2 μl), HSD-F (1 μl), HSD-R (1 μl), 2×Phata master mix (25 μl), ddH2O (21 μl) The reaction conditions of PCR amplification were: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 60°C for 15 s, extension at 72°C for 30 s, total extension at 72°C for 3 min, and 30 cycles of amplification.

[0023] After ...

Embodiment 2

[0025] Site-directed mutagenesis of amino acid 32

[0026] In order to mutate the Asp(D) at the 32nd position in the parental amino acid sequence to Glu(E) to obtain the mutant D32E, using the plasmid 3α-HSD-pET22b in Example 1 as a template, the primers D32EF and D32ER were designed as follows:

[0027] D32EF: gtaggcatcgaaatacgcgatgc

[0028] D32ER: gcatcgcgtatTtcgatgcctac

[0029] The primers were used for PCR amplification of the whole plasmid, wherein the PCR amplification system was 50 μl in total, including: 3α-HSD-pET22b (2 μl), D32EF (1 μl), D32ER (1 μl), 2×Phata master mix (25 μl), ddH2O (21 μl); the reaction conditions for PCR amplification were: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 6 minutes, total extension at 72°C for 5 minutes, and a total of 20 cycles of amplification.

[0030] After PCR amplification, 5 μl of it was taken for electrophoresis detection, and the rema...

Embodiment 3

[0032] Site-directed mutagenesis of amino acid 114

[0033] In order to mutate Ser(S) at position 114 in the parental amino acid sequence to Gly(G) to obtain mutant S114G, using the plasmid 3α-HSD-pET22b in Example 1 as a template, design primers S114GF and S114GR as follows:

[0034] S114GF:agccgtcgtcatctcgGGcgtggcttccgcgcatctg

[0035] S114GR:cagatgcgcggaagccacgCCCgagatgacgacggct

[0036] The primers were used for PCR amplification of the whole plasmid, wherein the PCR amplification system was 50 μl in total, including: 3α-HSD-pET22b (2 μl), S114GF (1 μl), S114GR (1 μl), 2×Phata master mix (25 μl), ddH2O (21 μl); the reaction conditions for PCR amplification were: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 6 minutes, total extension at 72°C for 5 minutes, and a total of 20 cycles of amplification.

[0037] After PCR amplification, 5 μl of it was taken for electrophoresis detection, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a 3alpha-hydroxysteroid dehydrogenase mutant, nucleotide sequence for coding the 3alpha-hydroxysteroid dehydrogenase mutant and a kit. The 3alpha-HSD mutant is obtained by subjecting amino acid sequence as shown in SEQ ID No. 2 to point mutation, wherein the point mutation is the amino acid substitution of at least one locus selected from the 25th-37th sites, the 100th-120thsites and the 145th-166th sites. By the point mutation, 3alpha-hydroxysteroid dehydrogenase mutant protease with high catalytic activity is obtained, enzyme catalytic activity can be evidently increased by more than 60% as compared with 3alpha-HSD, and the enzyme catalytic activity can reach up to twice of the original enzyme catalytic activity; by using the mutant protease as the tool enzyme, the total bile acid content and enzymatic method detection efficiency of the kit are improved greatly, production cost is lowered, and the market competiveness of corresponding products is increased.

Description

technical field [0001] The invention relates to the fields of molecular biology and biotechnology, in particular to a 3α-hydroxysteroid dehydrogenase mutant, a coding nucleotide sequence and a kit. Background technique [0002] Bile acids, as an important component of bile, play an important role in metabolism. Liver lesions lead to an increase in the content of bile acids in serum, so the content of bile acids has become a common indicator for clinical examination of liver function. 3α-Hydroxysteroid dehydrogenase 3α-HSD is the testosterone One of the various steroid dehydrogenases secreted by Pseudomonas, which can act on a variety of steroid substrates. Clinically, 3α-HSD is used as a tool enzyme to measure the concentration of total bile acid (TBA) in human serum. It is a circulating enzyme The core component in the TBA kit, the quality of the kit product mainly depends on the quality of 3α-HSD enzyme. At present, the existing 3α-HSD is derived from the extraction or ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53C12Q1/26
CPCC12N9/0006C12Q1/26C12Y101/01213G01N2333/902
Inventor陈小茹吴传侠王敏
OwnerSHENZHEN AMTECH BIOENGINEERING LTD INC