Specific sgRNA for target knocking out human OC-2 genes and application

An OC-2, specific technology, applied in the fields of molecular biology and biomedicine, can solve problems such as difficulties and off-targets, and achieve the effect of reducing proliferation and good application prospects.

Active Publication Date: 2019-01-01
JINAN UNIVERSITY
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although the CRISPR / Cas9 system is one of the current gene editing tools, to apply it to a specific target gene, how to select an appropriate sequence, carefully design the sequence and obtain an efficient, specific, and precise sgRNA targeting the target gene is the key , and this is also one of the current technical difficulties, which is related to whether the sgRNA can correctly bind to the target gene, whether it will miss the target, and whether it can trigger the Cas9 protein to perform its cutting function correctly and accurately, which will directly affect the CRISPR / Cas9 system. Specific Knockout of Target Genes
After the cleavage is successful, the protein is indeed not expressed, or there is still partial expression, whether it is knocked down or knocked out, which brings great difficulties to the success of the experiment
[0006] At present, there is no report on the precise knockout of ONECUT2 through the CRISPR / Cas9 system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific sgRNA for target knocking out human OC-2 genes and application
  • Specific sgRNA for target knocking out human OC-2 genes and application
  • Specific sgRNA for target knocking out human OC-2 genes and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1 CRISPR / Cas9 Gene Knockout Vector Construction

[0058] 1. Selection and design of sgRNA targeting human OC-2 gene

[0059] The sequence of the CDS region of the OC-2 gene was analyzed in the NCBI database to determine the site to be knocked out, and finally the knockout site was determined to be exon 1 of the OC-2 gene. Through the sgRNA online design website (http: / / crispr.mit.edu / ), three high-scoring specific sgRNAs targeting exon 1 of the ONECUT2 gene were designed, and the off-target efficiency of the sgRNAs was evaluated.

[0060] The sequence of exon 1 is as follows (SEQ ID NO.1):

[0061] ATGAAGGCTGCCTACACCGCCTATCGATGCCTCACCAAAGACCTAGAAGGCTGCGCCATGAACCCGGAGCTGACAATGGAAAGTCTGGGCACTTTGCACGGGCCGGCCGGCGGCGGCAGTGGCGGGGGCGGCGGCGGGGCGGCGGGGGCGGCGGCGGGGGCCCGGGCCATGAGCAGGAGCTGCTGGCACGCCCCCCC

[0062] sgRNA#1 (SEQ ID NO.2):

[0063] ACTTTGCACGGGCCGGCCGG

[0064] sgRNA#2 (SEQ ID NO.3):

[0065] TTTGGTGAGGCATCGATAGG

[0066] sgRNA#3 (SEQ ID NO.4):

[0067] ...

Embodiment 2

[0100] Example 2 Cell Culture

[0101] Human ovarian cancer cell lines SKOV3, CAOV3, and human embryonic kidney epithelial cells (293T) were purchased from the ATCC Culture Center. The cells were cultured with DMEM medium (Gibco Company) containing 10% FBS, penicillin and streptomycin (Invitrogen Company) were added to the medium, and the final concentrations were 100 U / mL and 100 μg / mL, respectively, and cultured at 37°C Carbon dioxide incubator.

Embodiment 3

[0102] Example 3 lentiviral packaging

[0103] Human 293T cells in the logarithmic growth phase were digested with trypsin and finally prepared into a single cell suspension. The cells were counted (repeated three times), and the cell concentration was adjusted to 5×10 with DMEM complete medium 4 individual / mL. 293T cells were seeded in 100mm cell culture dishes and cultured by adding 7mL DMEM complete medium.

[0104] The day before transfection, the 293T cell culture medium was replaced with DMEM basal medium (without adding double antibody) for starvation culture. Core plasmid (LentiCRISPRv2 recombinant plasmid) 4 μg, psPAX2 (purchased from Addgene) 3 μg, pMD2G (purchased from Addgene) 1 μg, transfection reagent (FuGENE6) 24 μL supplemented with DMEM basal medium (without adding double antibody) to prepare a total volume of 200 μL transfection After incubating for 30 minutes in a cell culture incubator at 37°C, add it dropwise to a 293T cell culture dish that is almost c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides specific sgRNA for target knocking out human OC-2 genes and application. By adopting the OC-2 genes on a human genome as a target, a series of sgRNA molecules which are obtainedby a series of screening and analysis and can efficiently, specifically and accurately target the human OC-2 gene, as shown in SEQ ID NO.2 to 4. The invention also provides a lentivirus vector and alentivirus comprising the specific sgRNA at the same time. The invention also provides a method for knocking out human OC-2 genes by utilizing a CRISPR-Cas9 system, so that a stable OC-2 gene knockoutstrain can be obtained. The specific sgRNA provided by the invention can block the expression of OC-2 gene in an ovary cell by virtue of a CRISPR / Cas system, the proliferation, migration and invasioncapacity of the ovary cancer cells can be significantly inhibited, a novel direction and concept can be provided for the research and clinical treatment of the ovarian cancer, and the application prospect is good.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and biomedicine, and in particular relates to a specific sgRNA for targeted knockout of human OC-2 gene and its application. Background technique [0002] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR, Clustered Regularly Interspaced Short Palindromic Repeats) is a special sequence found in the genomes of various archaea in the late 1980s, and it is a continuous evolution in most bacteria and archaea An immune defense mechanism of adaptation. According to the sequence and structural characteristics of the Cas protein gene involved in the action, the CRISPR-Cas system can be divided into three types: I, II and III. The current CRISPR / Cas9 system is transformed from the simplest type II CRISPR. The system consists of single-stranded guide RNA (sgRNA) and a Cas9 protein with endonuclease activity. The DNA double-strand break is formed through the Cas9 protein, and the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867C12N5/10C12N15/90A61K31/7105A61P35/00
CPCA61K31/713A61P35/00C07K14/47C12N5/0693C12N15/113C12N15/86C12N15/907C12N2310/10C12N2510/00C12N2740/15043C12N2800/80C12N2810/10C12N2310/20
Inventor邓宁鲁统一
OwnerJINAN UNIVERSITY