Gene carrier for treating or preventing bietti's crystalline dystrophy and application of gene carrier

A retinal pigment and gene carrier technology, which is used in the introduction of foreign genetic material, gene therapy, genetic engineering and other directions using vectors to achieve the effect of delaying retinal degradation

A retinal pigment and gene carrier technology, which is used in the introduction of foreign genetic material, gene therapy, genetic engineering and other directions using vectors to achieve the effect of delaying retinal degradation

CN109136266AActive Publication Date: 2019-01-04深圳泓熙生物科技发展有限公司

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene carrier for treating or preventing bietti's crystalline dystrophy and application of gene carrier
  • Gene carrier for treating or preventing bietti's crystalline dystrophy and application of gene carrier
  • Gene carrier for treating or preventing bietti's crystalline dystrophy and application of gene carrier

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Construction and separation and purification of adenoviral vector

[0031] 1. Amplify the coding sequence of CYP4V2-HRH gene.

[0032] 1) NCBI query to obtain the cDNA sequence of human CYP4V2 gene (https: / / www.ncbi.nlm.nih.gov / nuccore / NM_207352.3), and synthesize the sequence (SEQ ID NO:1).

[0033] 2) According to the above sequence, use T2A to fuse the HRH short peptide nucleotide sequence, and send it to the company to synthesize the CYP4V2-HRH gene fragment (SEQ ID NO: 2).

[0034] 3) Design and synthesize primers, and use high-fidelity PCR to clone and amplify the CYP4V2-HRH sequence.

[0035] CYP4V2-F: CGCGGATCCATGGCGGGGCTCTGGCTGG

[0036] CYP4V2-R:GGTAAGCTTTTAGCGCGGTATGGCGC

[0037] 2. Amplify multiple general promoters

[0038] 1) Query Addgene (Cambridge non-profit plasmid resource bank) to obtain CBh, CAG, PGK and EF1α promoter sequences, plasmid ID: 42230, 16664, 21217 and 26797.

[0039] 2) Synthesize its DNA sequence (SEQ ID NO: 4 to SEQ ID...

Embodiment 2

[0084] Example 2: Verification of in vitro overexpression of adenoviral vectors

[0085] 1. Culture ARPE-19 cells in a twelve-well cell culture plate until 70% saturated.

[0086]2. Add 10000MOI AAV2-C9-pCAG-hCYP4V2-HRH and AAV2-C9-pRPE65-hCYP4V2-HRH viruses, incubate overnight, and package the corresponding AAV2-pCAG-hCYP4V2-HRH and AAV2 with unmodified AAV2 capsid plasmid - pRPE65-hCYP4V2-HRH virus was used as control.

[0087] 3. Change to fresh medium to continue culturing.

[0088] 4. After 3 days, collect the cells and extract the total protein of the cells.

[0089] 5. Western blot to verify the expression status of CYP4V2.

[0090] 6. Results such as Figure 7 Shown: 1 is the blank group without virus infection, which only expresses a very low amount of CYP4V2 protein; 2 is the AAV2-pCAG-hCYP4V2-HRH control group, the expression of CYP4V2 protein has increased, and a certain amount of HRH expression can be detected ; 3 is the AAV2-C9-pCAG-hCYP4V2-HRH group, compar...

Embodiment 3

[0091] Example 3: Functional verification of adenoviral vectors

[0092] 1. Establishment of BCD patient iPSC cell line

[0093] Using iPSC reprogramming technology (Cell.2006Aug 25; 126(4):663-76.Epub 2006Aug10.Induction of pluripotent stem cells from mouse embryonic and adultfibroblast cultures by defined factors.Takahashi K1,Yamanaka S.) to extract normal people and BCD Peripheral blood cells from the patient were cultured in CD34+ serum-free medium for 10 days, then electrotransfected with Yamanaka four-factor plasmid, added with serum-free culture for two days, then transferred to Geltrex-treated cell culture plates, and continued to grow into iPSCs in stem cell medium E8 Clones appear. Usually, iPSCs appear after two weeks. When the clone grows to be visible to the naked eye, it can be subcultured and expanded for the next step of cell differentiation experiment.

[0094] 2. BCD patient and normal human RPE cell differentiation

[0095] RPE cell differentiation was pe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene carrier for treating or preventing bietti's crystalline dystrophy (BCD) and application of the gene carrier. The gene carrier for treating or preventing bietti's crystalline dystrophy comprises a packaging plasmid and a carrier plasmid. The packaging plasmid is an AAV2 packaging plasmid where a gene sequence of anti-CD59 short-chain-polypeptide C9 is inserted; the carrier plasmid is an AAV carrier plasmid where a gene sequence of human cytochrome P450 superfamily protein CYP4V2, a gene sequence of anti-VEGF short-chain-polypeptide HRH and a starting sub sequenceare inserted. The AAV carrier can conduct fusion expression on C9 anti-CD59 short-chain-polypeptide to virus coat protein; coexpression of CYP4V2 and HRH can be achieved, protein function loss causedby CYP4V2 genic mutation in a RPE cell is compensated for, the normal function of the RPE cell can be effectively repaired, specificity antagonism of a vascular endothelial growth factor (VEGF) can be achieved, and retinal atrophy caused by choroid hyperplasia is delayed. The invention further application of the gene carrier to preparation of medicine for treating or preventing bietti's crystalline dystrophy (BCD).

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a gene carrier, in particular to a gene carrier for treating or preventing crystalline retinitis pigmentosa (Bietti's crystalline dystrophy, BCD) and its use. Background technique [0002] Crystalline retinitis pigmentosa (Bietti's crystalline dystrophy, BCD) is a hereditary retinal degenerative eye disease. Patients generally develop night blindness in adolescence; as the disease progresses, yellow-white crystalline lipid crystals appear in the cornea and fundus, accompanied by visual field loss; in the advanced stage of the disease, the patient's retina shrinks and eventually becomes blind1. The disease is a rare disease in the West, but in Asia, especially in China, it has a relatively high incidence (1 / 20000) (Hu, D.-N. (1983). Ophthalmic genetics in China. Ophthalmic Paediatrics and Genetics, 2 (1), 39-45.). Unfortunately, there is currently no effective treatmen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
04 Jan 2019
Publication
CN109136266A
IPC
C12N15/864; A61K48/00; A61P27/02; A61P9/10
CPC
A61K48/005; A61P9/10; A61P27/02; C12N15/86; C12N2750/14143
Inventors
连祺周; 张昭