Gene carrier for treating or preventing crystalline retinitis pigmentosa and use thereof

A retinal pigment and gene carrier technology, which is used in the introduction of foreign genetic material, gene therapy, genetic engineering, etc.

Active Publication Date: 2022-02-18
深圳泓熙生物科技发展有限公司
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Unfortunately, there are currently no effective treatments for the disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene carrier for treating or preventing crystalline retinitis pigmentosa and use thereof
  • Gene carrier for treating or preventing crystalline retinitis pigmentosa and use thereof
  • Gene carrier for treating or preventing crystalline retinitis pigmentosa and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Construction and separation and purification of adenoviral vector

[0031] 1. Amplify the coding sequence of CYP4V2-HRH gene.

[0032] 1) NCBI query to obtain the cDNA sequence of human CYP4V2 gene (https: / / www.ncbi.nlm.nih.gov / nuccore / NM_207352.3), and synthesize the sequence (SEQ ID NO:1).

[0033] 2) According to the above sequence, use T2A to fuse the HRH short peptide nucleotide sequence, and send it to the company to synthesize the CYP4V2-HRH gene fragment (SEQ ID NO: 2).

[0034] 3) Design and synthesize primers, and use high-fidelity PCR to clone and amplify the CYP4V2-HRH sequence.

[0035] CYP4V2-F: CGCGGATCCATGGCGGGGCTCTGGCTGG

[0036] CYP4V2-R:GGTAAGCTTTTAGCGCGGTATGGCGC

[0037] 2. Amplify multiple general promoters

[0038] 1) Query Addgene (Cambridge non-profit plasmid resource bank) to obtain CBh, CAG, PGK and EF1α promoter sequences, plasmid ID: 42230, 16664, 21217 and 26797.

[0039] 2) Synthesize its DNA sequence (SEQ ID NO: 4 to SEQ ID...

Embodiment 2

[0084] Example 2: Verification of in vitro overexpression of adenoviral vectors

[0085] 1. Culture ARPE-19 cells in a twelve-well cell culture plate until 70% saturated.

[0086]2. Add 10000MOI AAV2-C9-pCAG-hCYP4V2-HRH and AAV2-C9-pRPE65-hCYP4V2-HRH viruses, incubate overnight, and package the corresponding AAV2-pCAG-hCYP4V2-HRH and AAV2 with unmodified AAV2 capsid plasmid - pRPE65-hCYP4V2-HRH virus was used as control.

[0087] 3. Change to fresh medium to continue culturing.

[0088] 4. After 3 days, collect the cells and extract the total protein of the cells.

[0089] 5. Western blot to verify the expression status of CYP4V2.

[0090] 6. Results such as Figure 7 As shown: 1 is the blank group without virus infection, which only expresses a very low amount of CYP4V2 protein; 2 is the AAV2-pCAG-hCYP4V2-HRH control group, the expression of CYP4V2 protein has increased, and a certain amount of HRH expression can be detected ; 3 is the AAV2-C9-pCAG-hCYP4V2-HRH group, com...

Embodiment 3

[0091] Example 3: Functional verification of adenoviral vectors

[0092] 1. Establishment of BCD patient iPSC cell line

[0093] Using iPSC reprogramming technology (Cell.2006Aug 25; 126(4):663-76.Epub 2006Aug10.Induction of pluripotent stem cells from mouse embryonic and adultfibroblast cultures by defined factors.Takahashi K1,Yamanaka S.) to extract normal people and BCD Peripheral blood cells from the patient were cultured in CD34+ serum-free medium for 10 days, then electrotransfected with Yamanaka four-factor plasmid, added with serum-free culture for two days, then transferred to Geltrex-treated cell culture plates, and continued to grow into iPSCs in stem cell medium E8 Clones appear. Usually, iPSCs appear after two weeks. When the clone grows to be visible to the naked eye, it can be subcultured and expanded for the next step of cell differentiation experiment.

[0094] 2. BCD patient and normal human RPE cell differentiation

[0095] RPE cell differentiation was pe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene carrier for treating or preventing crystalline retinitis pigmentosa (BCD) and its application. The gene carrier used for treating or preventing crystalline retinitis pigmentosa according to the present invention includes: packaging plasmid, which is an AAV2 packaging plasmid inserted with the gene sequence of anti-CD59 short peptide C9; and carrier plasmid, which is inserted with human cytochrome The gene sequence of the P450 superfamily protein CYP4V2, the gene sequence of the anti-VEGF short peptide HRH, and the AAV vector plasmid of the promoter sequence. The AAV vector can fuse and express C9 anti-CD59 short peptide to virus capsid protein; it can realize the co-expression of CYP4V2 and HRH, compensate for the loss of protein function caused by the mutation of CYP4V2 gene in RPE cells, and can effectively restore the normal function of RPE cells, and can specifically Antagonize vascular endothelial growth factor VEGF, delay retinal atrophy caused by choroidal hyperplasia. The invention also provides the use of the gene carrier for preparing medicine for treating or preventing crystalline retinitis pigmentosa (BCD).

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a gene carrier, in particular to a gene carrier for treating or preventing crystalline retinitis pigmentosa (Bietti's crystalline dystrophy, BCD) and its use. Background technique [0002] Crystalline retinitis pigmentosa (Bietti's crystalline dystrophy, BCD) is a hereditary retinal degenerative eye disease. Patients generally develop night blindness in adolescence; as the disease progresses, yellow-white crystalline lipid crystals appear in the cornea and fundus, accompanied by visual field loss; in the advanced stage of the disease, the patient's retina shrinks and eventually becomes blind1. The disease is a rare disease in the West, but in Asia, especially in China, it has a relatively high incidence (1 / 20000) (Hu, D.-N. (1983). Ophthalmic genetics in China. Ophthalmic Paediatrics and Genetics, 2 (1), 39-45.). Unfortunately, there is currently no effective treatmen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/864A61K48/00A61P27/02A61P9/10
CPCA61K48/005A61P9/10A61P27/02C12N15/86C12N2750/14143
Inventor连祺周张昭
Owner深圳泓熙生物科技发展有限公司