Unlock instant, AI-driven research and patent intelligence for your innovation.

Organic solvent tolerant aminopeptidase LapA and preparation method and application thereof

A technology of organic solvents and aminopeptidases, applied in botany equipment and methods, biochemical equipment and methods, applications, etc., to achieve good temperature stability

Active Publication Date: 2019-01-08
ANHUI UNIVERSITY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although many commercial aminopeptidases LapA have been used in the food industry, one of the main challenges in applying aminopeptidase LapA is to discover their unique ability to catalyze in extremes of temperature, pH and organic solvents

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Organic solvent tolerant aminopeptidase LapA and preparation method and application thereof
  • Organic solvent tolerant aminopeptidase LapA and preparation method and application thereof
  • Organic solvent tolerant aminopeptidase LapA and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] 1. Materials

[0032] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are all commercially available products unless otherwise specified.

[0033] 2. Method

[0034] 2.1 Gene cloning

[0035] The whole genome sequence of Legionella pneumophila was predicted from the bioinformatics database, and the target gene sequence (Gene ID: 19834379) was found. According to the target gene sequence, Primer Premier 5.0 was used to design primers, and NcoI and XhoI restriction endonuclease sites were introduced at the 5' end and 3' end of the target gene, respectively. The primer sequences were designed as follows:

[0036] Upstream primer: 5'CCCG CCATGG GAATGTTGTTTGCAATATTCGTTTCATC 3', the underline indicates the NcoⅠ restriction site;

[0037] Downstream primers:

[0038] 5'CCG CTCGAG CTCGGAAGCGAGTTCAATAGCGAAAG 3', the underline indicates the XhoI restriction s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an organic solvent tolerant aminopeptidase LapA and a preparation method and application thereof, and belongs to the field of gene engineering, protein expression and purification and enzymological feature research. The aminopeptidase LapA comes from legionella pneumophila and has an amino acid sequence as shown in SEQ ID NO.1 and a nucleotide sequence as shown in SEQ ID NO.2. Serving as an exogenous protease, the aminopeptidase has favorable temperature stability and organic solvent tolerance, can adapt to extreme high-concentration organic solvent reaction conditions,and lays a favorable foundation for industrialization of the aminopeptidase LapA and application of the aminopeptidase LapA in fermented food processing industry.

Description

technical field [0001] The invention belongs to the fields of genetic engineering technology, protein expression and purification, and enzymatic characteristics research, and specifically relates to an organic solvent-tolerant aminopeptidase LapA, its coding gene and application, its recombinant Escherichia coli and its construction method, and the production of LapA protein. Methods of expression and purification in vitro and identification of LapA enzymatic properties. Background technique [0002] Peptidases (EC 3.4) have widespread applications in detergent, leather, pharmaceutical and food industries, and peptidases account for 65% of the global enzyme market. Peptidases are powerful tools in the food industry to enhance the digestibility and solubility as well as the flavor and functional properties of food proteins. Most peptidases studied before were endoproteases, and exoproteases have attracted much attention in recent decades due to their different cleavage sites...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/48C12N15/57C12N15/70C12N1/21C12Q1/37C12R1/19
CPCC12N9/485C12N15/70C12Q1/37C12Y304/11
Inventor 张楠楠胡馨益葛宏华
Owner ANHUI UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More