A nucleic acid aptamer and its application in detection of pathogenic Vibrio alginolyticus

A technology of nucleic acid aptamer and vibrio alginolyticus, which is applied in the direction of measuring devices, instruments, biochemical equipment and methods, etc., can solve the problems of non-pathogenic vibrio alginolyticus detection and diagnosis, and achieve good application prospects, High affinity and specificity, good reproducibility

Active Publication Date: 2021-11-09
GUANGXI ACAD OF SCI
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention is to provide a highly specific, highly sensitive, non-immunogenic, stable and easily modified ssDNA aptamer for the detection of pathogenic Vibrio alginolyticus, which is convenient for synthesis and storage, to at least solve the existing The problem that the current biological detection technology cannot quickly and accurately detect and diagnose pathogenic Vibrio alginolyticus on the spot

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A nucleic acid aptamer and its application in detection of pathogenic Vibrio alginolyticus
  • A nucleic acid aptamer and its application in detection of pathogenic Vibrio alginolyticus
  • A nucleic acid aptamer and its application in detection of pathogenic Vibrio alginolyticus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The preparation method of embodiment 1ssDNA nucleic acid aptamer is as follows:

[0035] Step 1: Synthesize a random ssDNA library and primers shown in the sequence below

[0036] Random library Library50:

[0037] 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC;

[0038] 5' primer: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3';

[0039] 3' primer: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3';

[0040]Step 2: Dissolve 10 nmol of the above random library in 500 μl PBS, place in a constant temperature water bath at 92°C for 5 minutes, then quickly insert it into ice, and place it in an ice bath for 10 minutes, and incubate the treated random library with Vibrio alginolyticus live bacteria on ice for 1 hour; incubate After the binding is completed, remove the supernatant by centrifugation, wash the Vibrio alginolyticus live bacteria with 10mL of PBS, bathe in a constant temperature water bath at 92°C for 10 minutes, and collect the supernatant by centrifugation at 12000g, which is the...

Embodiment 2

[0050] According to the steps of Example 1, a rapid detection method (AFMP) for pathogenic Vibrio alginolyticus derived from pompano ovata based on the nucleic acid aptamer of SEQ ID NO: 1 was constructed and 4 different strains of Vibrio alginolyticus were detected.

[0051] Such as image 3 As shown, the above-mentioned rapid detection method (AFMP) can specifically identify four different strains of Vibrio alginolyticus (TOQZ01, TOQZ02, TOQZ03, TOQZ04), but no obvious identification of Vibrio harveyi in the control group occurred.

Embodiment 3

[0053] The ssDNA nucleic acid aptamer obtained in Example 1 was used to assemble an AFMP kit to form an AFMP detection kit for diagnosing whether fish are infected by Vibrio alginolyticus.

[0054] based on figure 1 , 2 , 3 results, it can be proved that the ssDNA nucleic acid aptamer shown in Example 1 of the present invention can still be combined with lysate after being modified by biotin, enzyme, fluorescein isothiocyanate, hydroxyl fluorescein and other fluorescent substances or luminescent materials. Vibrio alginolyticus can be used for the detection of pathogenic Vibrio alginolyticus derived from pompano ovata through specific binding.

[0055] The ssDNA nucleic acid aptamer screened by the SELEX technology in Example 1 of the present invention has good affinity and specificity, and the ssDNA nucleic acid aptamer of the embodiment of the present invention has a stable structure, and after group labeling and modification, it still has Better affinity and specificity ca...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a ssDNA nucleic acid aptamer and its application in pathogenic Vibrio alginolyticus. The nucleotide sequence of the ssDNA nucleic acid aptamer is 5'-GACGCTTACTCAGGTGTGACTCGCGTTTTATTGGTGTGGGGCTGGGGCGGTGGGTGGCTCTACTGGTTCCGTTCGAAGGACGCAGATGAAGTCTC-3' (SEQ ID No: 1). The ssDNA nucleic acid aptamer of the invention has specificity and high sensitivity to the pathogenic Vibrio alginolyticus derived from pomfret ovata, and has no immunogenicity. The ssDNA nucleic acid aptamer has a stable structure, is easy to modify, and is convenient for synthesis and storage, and can quickly and accurately detect and diagnose pathogenic Vibrio alginolyticus derived from pomfret ovata.

Description

technical field [0001] The invention relates to an ssDNA nucleic acid aptamer and its screening method, detection method and application, in particular to an ssDNA nucleic acid aptamer and its application in detecting pathogenic Vibrio alginolyticus. Background technique [0002] As a big country in aquaculture, my country's aquaculture volume accounts for 70% of the world's total aquatic product farming. However, the outbreak and prevalence of bacterial pathogens in recent years have caused huge economic losses to the aquaculture industry in my country. In Guangxi and other coastal areas of South China, Vibrio alginolyticus is one of the main pathogenic bacteria that cause bacterial fish diseases in seawater cultured fish. The fish diseases caused by it have rapid onset, high mortality and wide prevalence. Aquaculture development is seriously threatened. At present, the diagnosis of fish bacterial diseases in the world mainly adopts traditional observation methods, immuno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/115C12N15/10G01N33/569
CPCC12N15/1048C12N15/115C12N2310/16G01N33/56911
Inventor李鹏飞余庆刘明珠李菲覃仙玲吴思婷肖贺贺陈波
OwnerGUANGXI ACAD OF SCI