A nucleic acid aptamer and its application in detection of pathogenic Vibrio alginolyticus
A technology of nucleic acid aptamer and vibrio alginolyticus, which is applied in the direction of measuring devices, instruments, biochemical equipment and methods, etc., can solve the problems of non-pathogenic vibrio alginolyticus detection and diagnosis, and achieve good application prospects, High affinity and specificity, good reproducibility
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] The preparation method of embodiment 1ssDNA nucleic acid aptamer is as follows:
[0035] Step 1: Synthesize a random ssDNA library and primers shown in the sequence below
[0036] Random library Library50:
[0037] 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC;
[0038] 5' primer: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3';
[0039] 3' primer: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3';
[0040]Step 2: Dissolve 10 nmol of the above random library in 500 μl PBS, place in a constant temperature water bath at 92°C for 5 minutes, then quickly insert it into ice, and place it in an ice bath for 10 minutes, and incubate the treated random library with Vibrio alginolyticus live bacteria on ice for 1 hour; incubate After the binding is completed, remove the supernatant by centrifugation, wash the Vibrio alginolyticus live bacteria with 10mL of PBS, bathe in a constant temperature water bath at 92°C for 10 minutes, and collect the supernatant by centrifugation at 12000g, which is the...
Embodiment 2
[0050] According to the steps of Example 1, a rapid detection method (AFMP) for pathogenic Vibrio alginolyticus derived from pompano ovata based on the nucleic acid aptamer of SEQ ID NO: 1 was constructed and 4 different strains of Vibrio alginolyticus were detected.
[0051] Such as image 3 As shown, the above-mentioned rapid detection method (AFMP) can specifically identify four different strains of Vibrio alginolyticus (TOQZ01, TOQZ02, TOQZ03, TOQZ04), but no obvious identification of Vibrio harveyi in the control group occurred.
Embodiment 3
[0053] The ssDNA nucleic acid aptamer obtained in Example 1 was used to assemble an AFMP kit to form an AFMP detection kit for diagnosing whether fish are infected by Vibrio alginolyticus.
[0054] based on figure 1 , 2 , 3 results, it can be proved that the ssDNA nucleic acid aptamer shown in Example 1 of the present invention can still be combined with lysate after being modified by biotin, enzyme, fluorescein isothiocyanate, hydroxyl fluorescein and other fluorescent substances or luminescent materials. Vibrio alginolyticus can be used for the detection of pathogenic Vibrio alginolyticus derived from pompano ovata through specific binding.
[0055] The ssDNA nucleic acid aptamer screened by the SELEX technology in Example 1 of the present invention has good affinity and specificity, and the ssDNA nucleic acid aptamer of the embodiment of the present invention has a stable structure, and after group labeling and modification, it still has Better affinity and specificity ca...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap