Planthopper lethal gene fragment and application thereof

A technology of gene fragments and planthoppers, which is applied in the field of agricultural biology, can solve problems such as environmental pollution and poor drug control effects, and achieve the effects of low synthesis cost, significant lethal effect, and easy large-scale application

Inactive Publication Date: 2019-02-01
ZHEJIANG UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Planthopper lethal gene fragment and application thereof
  • Planthopper lethal gene fragment and application thereof
  • Planthopper lethal gene fragment and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Cloning method of beta-tubulin gene fragment:

[0037] (1) Get 10-20 heads of SBPH, and use the TRIzol method to extract total RNA;

[0038] (2) Synthesizing the first strand of cDNA;

[0039] (3) Obtain the gene fragment sequence from the SBPH transcriptome, in http: / / www.ncbi.nlm.nih.gov / After the homology comparison, it was predicted to be the beta-tubulin gene of SBPH, and P1 and P2 were designed using Primer premier 5.0 software, and amplified by RT-PCR;

[0040] Upstream primer (P1): 5'AAATTGTAAGTGAAATCTG 3'(SEQ ID NO.2),

[0041] Downstream primer (P 2): 5'GGCAAGAAGGAGAATTTA 3' (SEQ ID NO.3);

[0042] PCR conditions are: denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 55°C, 30sec at 72°C, 35 cycles, extension at 72°C

[0043] PCR reaction system (50μL):

[0044]

[0045] (4) The PCR product is separated by agarose gel electrophoresis, and the target DNA fragment is recovered;

[0046] (5) Insert the recovered target fragment into the pEASY-T3 ...

Embodiment 2

[0049] Embodiment 2.dsRNA synthesis and recovery

[0050] (1) According to the verified beta-tubulin gene fragment sequence, use Primer Premier 5.0 software to design P 3 and P 4;

[0051] Upstream primer (P3): 5'TAATACGACTCACTATAGGGTTGACCAGTCGGGAGTGT 3'(SEQ ID NO.5)

[0052] Downstream primer (P4): 5'TAATACGACTCACTATAGGGGGTGATGGCATAACAGAA 3'(SEQ ID NO.6)

[0053]

[0054]

[0055] PCR conditions: Denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 60°C, 30sec at 72°C, 38 cycles, extension at 72°C.

[0056] (2) The PCR product was separated by electrophoresis on a 1% low-melting point agarose gel and observed under ultraviolet light. The sequence is shown in SEQ ID NO.4.

[0057] (3) Using Promega's SV Gel and PCR Clean-Up System kit for recovery:

[0058] ① Cut the gel of the separated target fragment, put it into a 1.5ml microcentrifuge tube that has been weighed in (a), weigh (b) again, and calculate the weight of the cut gel in b-a;

[0059] ② According to ...

Embodiment 3

[0067] Example 3 Planthopper feeding dsRNA experiment

[0068] (1) Seal one end of the glass tube with a parafilm, absorb second-instar planthoppers (BPH, BPH) into different glass tubes with an insect sucker, and seal the other end with gauze;

[0069] (2) Gently pat the insects to one end with your hands, remove the gauze from the other end, and put the prepared parafilm sticker face up, pull evenly to both sides, pull it into a square, and then cover it on the glass On the nozzle of the tube, place the tube upright on the ultra-clean table;

[0070] (3) Use a pipette to draw 100 μl of feed and drop it in the center of the parafilm. The control group only adds feed (see Table 2 for the formula). The dsRNA of the beta-tubulin gene is added to the feed in the treatment group. The dsRNA concentration is 5200 ng / μl. A new parafilm, with the sticker side down, is attached to the mouth of the glass tube, and the feed and dsRNA are sealed between the two layers of parafilm;

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a planthopper lethal gene fragment and an application thereof. The planthopper lethal gene fragment beta-tubulin causing death of planthopper after interference and having thesequence shown in SEQ ID NO.1 is screened out; laodelphax striatellus and brown planthopper are fed with dsRNA of the gene fragment and can be effectively killed; the gene fragment is safe to both theenvironment ecology and food and provides a new way to control pests by using the RNA interference technology.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and relates to planthopper lethal gene fragments and applications thereof. Background technique [0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle. In addition, the rice stripe leaf blight caused by the stripe virus transmitted by the striatellus striatellus is poorly controlled by pesticides after the onset, so we can only rely on pest control to prevent disease. Therefore, in the practice of agricultural production, there is an urgent need for alternative control methods other than chemical pesticides. [0003] RNA interference (RNA interference, RNAi) is a gene silencing phenomenon mediated by double...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/12C07K14/435C12N15/113A01N37/46A01P7/04
CPCA01N37/46C07K14/43563
Inventor 王亚琴王书平李飞贺康肖花美胡涛
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap