Gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof

A gene fragment and the technology of SBPH, applied in the field of agricultural biology, can solve the problems of poor chemical control effect and environmental pollution, and achieve the effects of reducing mechanical damage, facilitating experimental operation, and low synthesis cost

Inactive Publication Date: 2011-10-19
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle
In addition, rice stripe leaf blight caused by stripe virus transmitted by SBPH is poorly controlled by pesticides after the onset, and can only be controlled by pest control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof
  • Gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof
  • Gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1. Cloning method of Chitinase 7 gene fragment:

[0038] (1) Take 10-20 L. striatellus heads and extract total RNA with TRIzol method;

[0039] (2) Synthesize the first strand of cDNA;

[0040] (3) Obtain the gene fragment sequence from the L. striatellus transcriptome, and after the homology comparison at http: / / www.ncbi.nlm.nih.gov / , it is predicted that it is the L. striatellus Chitinase 7 gene, using Primer premier 5.0 software design P1 and P2, amplified by RT-PCR method;

[0041] Upstream primer (P1): 5' GTGCTGCTGGATACGAT 3' (SEQ ID NO. 2),

[0042] Downstream primer (P2): 5' GTCTGTAGGCGAATGGT 3' (SEQ ID NO. 3);

[0043] The PCR reaction program was: denaturation at 94°C for 2 min, 94°C for 30sec, 55°C for 30sec, 72°C for 30sec, 35 cycles, and extension at 72°C

[0044] PCR reaction system (50μL):

[0045]

[0046]

[0047] (4) The PCR product is separated by agarose gel electrophoresis, and the target DNA fragment is recovered;

[0048] (5) Insert the...

Embodiment 2

[0052] Example 2. dsRNA synthesis and recovery

[0053] (1) According to the verified Chitinase 7 gene fragment sequence, use Primer Premier 5.0 software to design P3 and P4, and add the T7 promoter sequence TAATACGACTCACTATAGGG to the 5' end of the upstream and downstream primers;

[0054] Upstream primer (P4): 5' TAATACGACTCACTATAGGGTGCTGCTGGATACGAT 3' (SEQ ID NO. 5)

[0055] Upstream primer (P5): 5' TAATACGACTCACTATAGGGTCTGTAGGCGAATGGT 3' (SEQ ID NO. 6)

[0056]

[0057] PCR reaction program: denaturation at 94°C for 2 min, 94°C for 30sec, 60°C for 30sec, 72°C for 30sec, 38 cycles, and extension at 72°C.

[0058] (2) PCR products were separated by low-melting agarose gel electrophoresis with a concentration of 1% and observed under UV light. The results are shown in figure 1 , and its sequence is shown in SEQ ID NO.4.

[0059] (3) Using Promega's SV Gel and PCR Clean-Up System kit for recovery:

[0060] ① Cut the gel from the target fragment obtained by separation,...

Embodiment 3

[0070] Example 3. dsRNA feeding experiment

[0071] (1) Seal one end of the glass tube with parafilm, use a fluke to absorb the second-instar S. lugens into the glass tube, and seal the other end with gauze;

[0072] (2) Gently tap the insects to one end, remove the gauze at the other end, turn the prepared parafilm sticker side up, pull it to both sides with even force, pull it into a square, and then cover it to the glass On the pipe orifice, place the pipe upright on the ultra-clean table;

[0073] (3) Pipette 100 μl of feed and drop it on the center of the parafilm. For the control group, only feed was added (see Table 1 for the formula). The treatment group added dsRNA of Chitinase 7 gene to the feed. The concentration of dsRNA was 3214 ng / μl. A new parafilm, with the sticker side down, is attached to the mouth of the glass tube, and the feed and dsRNA are sealed between the two layers of parafilm;

[0074] (4) Put the glass tube with the feed and dsRNA back on the worm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of agricultural biology, and in particular relates to gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof. In the patented invention, a dsRNA feeding method improved in laboratories is used for screening out the lethal gene fragment Chitinase 7 of the laodelphax striatellus as shown in SEQ ID NO. 1 from laodelphax striatellus, wherein the lethal gene fragment Chitinase 7 of the laodelphax striatellus can lead to the death of laodelphax striatellus after being interfered; the dsRNA of the gene fragment is used for feeding the laodelphax striatellus so as to ensure that the death rate of the laodelphax striatellus reaches 70%; and the lethal gene fragment Chitinase 7 and the dsRNA thereof provide a sequence and data basis for establishing a new strategy of controlling injurious insects by using an RNA interference technology.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and relates to the lethal gene fragment Chitinase 7 of S. striatellus based on gene silencing technology and its dsRNA. Background technique [0002] In my country, the continuous single and long-term use of chemical agents has resulted in different degrees of resistance of S. lugens to a variety of pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. Vicious circle. In addition, the rice stripe leaf blight caused by the streak virus transmitted by the streak of striatellus planthoppers has poor effect of chemical control after the onset, and can only rely on pest control. Therefore, in agricultural production practice, alternative control methods other than chemical pesticides are urgently needed. [0003] RNA interference (RNAi) is a phenomenon of gene silencing me...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/113C12N15/10A01K67/033
Inventor李飞李国清董双林韩召军姜卫华
OwnerNANJING AGRICULTURAL UNIVERSITY