Laodelphax striatellus lethal gene fragment
A technology of gene fragment and SBPH, applied in the field of agricultural biology, can solve the problems of poor chemical control effect and environmental pollution, and achieve the effects of reducing mechanical damage, facilitating experimental operation and low synthesis cost.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] 1. Cloning method of Tubulin gene fragment:
[0039] (1) Take 10-20 heads of SBPH, and use the TRIzol method to extract total RNA;
[0040] (2) Synthesize the first strand of cDNA;
[0041] (3) Obtain the gene fragment sequence from the SBPH transcriptome, and after homology comparison at http: / / www.ncbi.nlm.nih.gov / , it is predicted to be the SBPH Tubulin gene, using Primer premier 5.0 Software designed P 1 and P 2, amplified by RT-PCR method;
[0042] Upstream primer (P1): 5' GCGACTTGTGAACCTG 3' (SEQ ID NO.2),
[0043] Downstream primer (P 2): 5' TCTGCTGACGCTGAAA 3' (SEQ ID NO.3);
[0044] The PCR reaction program was: denaturation at 94°C for 2 min, 30 sec at 94°C, 30 sec at 55°C, 30 sec at 72°C, 35 cycles, and extension at 72°C.
[0045] PCR reaction system (50μL):
[0046]
[0047]
[0048] (4) The PCR product is separated by agarose gel electrophoresis, and the target DNA fragment is recovered;
[0049] (5) Insert the recovered target fragment into the...
Embodiment 2
[0053] Example 2. dsRNA synthesis and recovery
[0054] (1) According to the verified Tubulin gene fragment sequence, use Primer Premier 5.0 software to design P3 and P4, and add the T7 promoter sequence TAATACGACTCACTATAGGG at the 5' end of the upstream and downstream primers;
[0055] Upstream primer (P 4): 5' TAATACGACTCACTATAGGGGCGACTTGTGAACCTG 3' (SEQ ID NO.5)
[0056] Upstream primer (P 5): 5' TAATACGACTCACTATAGGGTCTGCTGACGCTGAAA 3' (SEQ ID NO.6)
[0057]
[0058] PCR reaction program: denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 60°C, 30sec at 72°C, 38 cycles, extension at 72°C.
[0059] (2) The PCR products were separated by electrophoresis on 1% low-melting point agarose gel and observed under ultraviolet light. The results are shown in figure 1 , whose sequence is shown in SEQ ID NO.4.
[0060] (3) Using Promega's Wizard? SV Gel and PCR Clean-Up System kit for recovery:
[0061] ① Cut the gel of the separated target fragment, put it into a 1.5ml micr...
Embodiment 3
[0071] Example 3. dsRNA feeding experiment
[0072] (1) Seal one end of the glass tube with a parafilm, suck the second-instar SBPH into the glass tube with a sucker, and seal the other end with gauze;
[0073] (2) Gently pat the insects to one end with your hands, remove the gauze from the other end, put the prepared parafilm sticker side up, pull evenly to both sides, pull it into a square, and then cover it on the glass On the nozzle of the tube, place the tube upright on the ultra-clean table;
[0074] (3) Use a pipette gun to draw 100 μl of feed and drop it on the center of the sealing film. The control group only added feed (see Table 2 for the formula), and the treatment group added dsRNA of the Tubulin gene (see Table 1 for the concentration) in the feed, and sealed it with a new one. Film, with the side of the sticker facing down, is pasted on the nozzle of the glass tube, and the feed and dsRNA are sealed between two layers of parafilm;
[0075] (4) Put the glass t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 