Gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof

A technology of gene fragment and SBPH, applied in the field of agricultural biology, can solve the problems of poor chemical control effect and environmental pollution, and achieve the effects of reducing mechanical damage, facilitating experimental operation and low synthesis cost.

Inactive Publication Date: 2011-10-19
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle
In addition, rice stripe leaf blight caused by stripe virus transmitted by SBPH is poorly controlled by pesticides after the onset, and can only be controlled by pest control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof
  • Gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof
  • Gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] 1. Cloning method of Chitinase gene fragment:

[0039] (1) Get 10-20 heads of SBPH, and use the TRIzol method to extract total RNA;

[0040] (2) Synthesizing the first strand of cDNA;

[0041] (3) Obtain the gene fragment sequence from the SBPH transcriptome, in http: / / www.ncbi.nlm.nih.gov / After the homology comparison, it was predicted to be the chitinase gene of S. striatellus, and P1 and P2 were designed using Primer premier 5.0 software, and amplified by RT-PCR method;

[0042] Upstream primer (P1): 5'TCACCAACTCGCCCATTA 3'(SEQ ID NO.2),

[0043] Downstream primer (P2): 5'AGCCTCGTCACTCACCTTT 3' (SEQ ID NO.3);

[0044] PCR conditions are: denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 55°C, 30sec at 72°C, 35 cycles, extension at 72°C

[0045] PCR reaction system (50μL):

[0046]

[0047]

[0048] (4) The PCR product is separated by agarose gel electrophoresis, and the target DNA fragment is recovered;

[0049] (5) Insert the recovered target frag...

Embodiment 2

[0053] Embodiment 2.dsRNA synthesis and recovery

[0054] (1) According to the verified Chitinase gene fragment sequence, use Primer Premier 5.0 software to design P3 and P4, and add the T7 promoter sequence TAATACGACTCACTATAGGG to the 5' end of the upstream and downstream primers;

[0055] Upstream primer (P4): 5'TAATACGACTCACTATAGGGTCACCAACTCGCCCATTA 3'(SEQ ID NO.5)

[0056] Upstream primer (P5): 5' TAATACGACTCACTATAGGGAGCCTCGTCACTCACCTTT 3' (SEQ ID NO.6)

[0057]

[0058] PCR conditions: Denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 60°C, 30sec at 72°C, 38 cycles, extension at 72°C.

[0059] (2) The PCR product was separated by electrophoresis on a low-melting point agarose gel with a concentration of 1% and observed under ultraviolet light. The results are shown in figure 1 , whose sequence is shown in SEQ ID NO.4.

[0060] (3) Using Promega's SV Gel and PCR Clean-Up System kit for recovery:

[0061] ① Cut the gel of the separated target fragment, put it ...

Embodiment 3

[0071] Embodiment 3.dsRNA feeding experiment

[0072] (1) Seal one end of the glass tube with a parafilm, suck the second-instar SBPH into the glass tube with a sucker, and seal the other end with gauze;

[0073] (2) Gently pat the insects to one end with your hands, remove the gauze from the other end, and put the prepared parafilm sticker face up, pull evenly to both sides, pull it into a square, and then cover it on the glass On the nozzle of the tube, place the tube upright on the ultra-clean table;

[0074] (3) Draw 100 μl of feed with a pipette gun and drop it in the center of the sealing film. The control only adds feed (see Table 2 for formula), and the treatment group adds dsRNA of Chitinase gene (see Table 1 for concentration) in the feed, and seals with a new one. Film, with the side of the sticker facing down, is pasted on the nozzle of the glass tube, and the feed and dsRNA are sealed between two layers of parafilm;

[0075] (4) Put the glass tube with feed and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of agricultural biology, and in particular relates to a gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof. In the patented invention, a dsRNA feeding method improved in laboratories is used for screening out the lethal gene fragment Chitinase 7 of the laodelphax striatellus as shown in SEQ ID NO. 1 from laodelphax striatellus, wherein the lethal gene fragment Chitinase 7 of the laodelphax striatellus can lead to the death of laodelphax striatellus after being interfered; the dsRNA of the gene fragment is used for feeding the laodelphax striatellus so as to ensure that the corrected death rate of the laodelphax striatellus reaches more than 65%; and the lethal gene fragment Chitinase 7 and the dsRNA thereof provide a sequence and data basis for establishing a new strategy of controlling injurious insects by using a RNA interference technology.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and relates to a lethal gene fragment Chitinase and dsRNA thereof based on gene silencing technology. Background technique [0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle. In addition, the rice stripe leaf blight caused by the stripe virus transmitted by the striatellus striatellus is poorly controlled by pesticides after the onset, so we can only rely on pest control to prevent disease. Therefore, in the practice of agricultural production, there is an urgent need for alternative control methods other than chemical pesticides. [0003] RNA interference (RNA interference, RNAi) is a gene silencing ph...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/113C12N15/10A01K67/033
Inventor 李飞李国清董双林韩召军姜卫华
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap