Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of OsRL7.1 protein to regulation and control of plant root development

A plant root and plant technology, applied in the fields of application, plant peptides, plant gene improvement, etc., can solve problems that affect the full utilization of cultivated land resources, difficult development of rice production, and impact on yield

Active Publication Date: 2019-02-05
CHINA AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Research shows that most of the water consumption of irrigated rice is not required for growth itself, but because it is not used efficiently
On the other hand, nearly half of the world's rice planting area is in a state of water shortage, which seriously affects the increase in its yield. In many areas of my country, due to the relative lack of irrigation water, it is difficult to develop rice production, which affects arable land resources to a certain extent. full use of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsRL7.1 protein to regulation and control of plant root development
  • Application of OsRL7.1 protein to regulation and control of plant root development
  • Application of OsRL7.1 protein to regulation and control of plant root development

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1, the acquisition of rice OsRL7.1 and its sequence analysis

[0049] 1. Obtaining of rice OsRL7.1

[0050]Using 795 seedling-stage cultivated rice germplasms (including 506 indica and 289 japonica) as the association analysis population, the genotype and root length phenotype of the association analysis population were analyzed and identified. Specific steps are as follows:

[0051] 1. Phenotypic identification of the root length of the association analysis population by hydroponics

[0052] 1) First, after washing the seeds with sterile water, place them in a tissue culture room at 32°C for 64 hours to accelerate germination.

[0053] 2) For each variety, 5 seeds with normal germination and consistent growth potential were selected and transplanted to foam boards (30cm×42cm) with gauze as the bottom. Each foam board can plant 22 varieties (110 plants) and 20 rice plants as protection rows, and every two foam boards can be placed in the same blue plastic box...

Embodiment 2

[0060] Example 2, Obtaining of Rice OsRL7.1 Mutant and Functional Analysis of OsRL7.1

[0061] 1. Obtainment and identification of rice OsRL7.1 mutant

[0062] 1. Obtaining the rice OsRL7.1 mutant

[0063] Mutant Ti-OsRL7.1 was purchased from Korea Mutant Bank (URL: http: / / cbi.khu.ac.kr / RISD_DB.html), catalog number PFG_3A-03803.R. The OsRL7.1 mutant was identified by sequencing, and the T-DNA sequence was inserted into the promoter region of the OsRL7.1 gene.

[0064] 2. PCR identification of rice OsRL7.1 mutant

[0065] The primers were designed on the OsRL7.1 gene and T-DNA insert sequence to identify the rice OsRL7.1 mutant. The designed primers are shown in Table 1, wherein LP and RP are designed on the gene, and RB is designed at the RB (right border) end of the T-DNA insertion sequence.

[0066] Table 1. List of primers for identification of mutant systems

[0067] Primer

sequence

LP

5'GACGAGTCGAGACTGACACG

RP

5'CGCTAATAAGCCGTTATGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of an OsRL7.1 protein to regulation and control of plant root development. The OsRL7.1 protein is a protein shown as a) or b) or c) or d), wherein a) is a protein of which the amino acid sequence is shown as a sequence 2SEQ ID NO: 2; (b) is a fused protein obtained by connecting a tag to the terminal N and / or terminal C of the protein shown as the sequence 2SEQID NO: 2; c) is a protein which has the same function and is obtained by performing substitution and / or deletion and / or addition of one or more amino acid residues on the amino acid sequence shown asthe sequence 2SEQ ID NO: 2; d) has the same function and has 75 percent or more of homology with the amino acid sequence shown as the sequence 2SEQ ID NO: 2. As proved by experiments, the normal development of the rice root system can be influenced by the OsRL7.1 gene mutation. The gene has the function of regulating and controlling the development of rice roots and primary roots, and can be applied to the improvement of the characters of the rice root system.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to the application of OsRL7.1 protein in regulating plant root development, in particular to the application of OsRL7.1 protein in regulating rice root development. Background technique [0002] Rice is one of the three major food crops in the world. Irrigated rice is currently the main rice production method, and its water consumption accounts for about 54% of the national water consumption and more than 65% of the national agricultural water consumption. Studies have shown that most of the water consumption of irrigated rice is not required for growth itself, but due to ineffective use. On the other hand, nearly half of the rice planting area in the world is in a state of water shortage, which seriously affects the increase of its yield. In many areas of my country, due to the relative lack of irrigation water, it is difficult to develop rice production, which affects arabl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82
CPCC07K14/415C12N15/8261
Inventor 李自超蒋聪慧赵炎邵雨洁赵为朋张洪亮李金杰
Owner CHINA AGRI UNIV