Application of olea europaea L.olive leaf extractive to preparation of drug for preventing and treating fetal alcohol syndrome
A technology of olive leaf extract and syndrome, applied in the directions of drug combination, pharmaceutical formula, plant raw material, etc., to achieve the effect of inhibiting the occurrence of apoptosis and reducing morphological changes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Preparation of olive leaf extract and morphological study on the protective effect on zebrafish embryos
[0039] 1. Preparation of olive leaf extract
[0040] (1) Sample pretreatment
[0041] Take the fresh olive leaves and dry them naturally in a cool, dry and ventilated place. After drying in the shade, dry them at 40°C to constant weight, crush them through a 60-mesh sieve, and use them as powder for later use.
[0042] (2) hot water extraction method
[0043] Weigh 100g of the powder, add 1L of pure water, extract at 55°C for 210min, centrifuge at 5000r / min for 10min after extraction, concentrate the supernatant to 100mL with a rotary evaporator, and freeze-dry to obtain the preparation HWE.
[0044] (3) Soxhlet extraction method
[0045] Weigh 100 g of the powder, add 3.5 L of 60% ethanol, conduct Soxhlet extraction at 80°C for 105 min, centrifuge at 5000 r / min for 10 min, concentrate the supernatant to 100 mL with a rotary evaporator, and freeze-dry t...
Embodiment 2
[0075] Example 2 Acridine Orange (AO) Fluorescent Staining Analysis to Detect Zebrafish Cell Apoptosis
[0076] 120hpf hatched larvae were stained with 7mg / L acridine orange at 28.5°C for 0.5h in the dark, then washed 3 times with embryo culture medium for 5min each time, anesthetized with 0.08% ethylene glycol phenyl ether for 2min, and placed under a fluorescent stereomicroscope for observation , take pictures, and use ImageJ software to analyze and measure the fluorescence intensity of larvae. See the result Figure 11 and Figure 12 .
[0077] Figure 11 To improve the acridine orange (AO) fluorescence staining results of 1.5% ethanol-treated zebrafish embryos / larvae at 120hpf for different olive leaf extracts; 12.5, 25 and 50 represent the concentration of olive leaf extract respectively, in mg / L; HWM: Olive leaf extract prepared by hot water extraction; SE: olive leaf extract prepared by Soxhlet extraction; UAE: olive leaf extract prepared with ultrasound assistance;...
Embodiment 3
[0080] Example 3 Study on Changes in the Expression of Apoptosis-Related Genes
[0081] 1. Primer design
[0082] The sequences of the internal reference β-Actin and the apoptosis-related genes Bax and Bcl-2 were queried on Genbank, and primers (see the sequence in Table 2) were designed using the primer5.0 software, and synthesized by Dalian Bao Biological Engineering Co., Ltd.
[0083] Table 2
[0084] Gene
Primer
serial number
Sequence (5'to 3')
β-actin
upstream primer
1
TCTGGTGATGGTTGACCCA
downstream primer
2
GGTGAAGCTGTAGCCACGCT
Bcl-2
upstream primer
3
TCACTCAGTTCAGACCTCTCAT
downstream primer
4
ACGCTTTCCACGCACAT
Bax
upstream primer
5
GGCTATTTCAACCAGGGTTCC
downstream primer
6
TGCGAATCACCAATGCTGT
[0085] 2. Extraction of total RNA and synthesis of cDNA
[0086] 14 experimental groups: Group V, Group E, Group E+HWM12.5, Group E+HWM 25, Grou...
PUM
Property | Measurement | Unit |
---|---|---|
Concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap