Application of olea europaea L.olive leaf extractive to preparation of drug for preventing and treating fetal alcohol syndrome

A technology of olive leaf extract and syndrome, applied in the directions of drug combination, pharmaceutical formula, plant raw material, etc., to achieve the effect of inhibiting the occurrence of apoptosis and reducing morphological changes

Active Publication Date: 2019-02-22
XIHUA UNIV
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Modern medicine has made great breakthroughs in the study of the etiolog

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of olea europaea L.olive leaf extractive to preparation of drug for preventing and treating fetal alcohol syndrome
  • Application of olea europaea L.olive leaf extractive to preparation of drug for preventing and treating fetal alcohol syndrome
  • Application of olea europaea L.olive leaf extractive to preparation of drug for preventing and treating fetal alcohol syndrome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Preparation of olive leaf extract and morphological study on the protective effect on zebrafish embryos

[0039] 1. Preparation of olive leaf extract

[0040] (1) Sample pretreatment

[0041] Take the fresh olive leaves and dry them naturally in a cool, dry and ventilated place. After drying in the shade, dry them at 40°C to constant weight, crush them through a 60-mesh sieve, and use them as powder for later use.

[0042] (2) hot water extraction method

[0043] Weigh 100g of the powder, add 1L of pure water, extract at 55°C for 210min, centrifuge at 5000r / min for 10min after extraction, concentrate the supernatant to 100mL with a rotary evaporator, and freeze-dry to obtain the preparation HWE.

[0044] (3) Soxhlet extraction method

[0045] Weigh 100 g of the powder, add 3.5 L of 60% ethanol, conduct Soxhlet extraction at 80°C for 105 min, centrifuge at 5000 r / min for 10 min, concentrate the supernatant to 100 mL with a rotary evaporator, and freeze-dry t...

Embodiment 2

[0075] Example 2 Acridine Orange (AO) Fluorescent Staining Analysis to Detect Zebrafish Cell Apoptosis

[0076] 120hpf hatched larvae were stained with 7mg / L acridine orange at 28.5°C for 0.5h in the dark, then washed 3 times with embryo culture medium for 5min each time, anesthetized with 0.08% ethylene glycol phenyl ether for 2min, and placed under a fluorescent stereomicroscope for observation , take pictures, and use ImageJ software to analyze and measure the fluorescence intensity of larvae. See the result Figure 11 and Figure 12 .

[0077] Figure 11 To improve the acridine orange (AO) fluorescence staining results of 1.5% ethanol-treated zebrafish embryos / larvae at 120hpf for different olive leaf extracts; 12.5, 25 and 50 represent the concentration of olive leaf extract respectively, in mg / L; HWM: Olive leaf extract prepared by hot water extraction; SE: olive leaf extract prepared by Soxhlet extraction; UAE: olive leaf extract prepared with ultrasound assistance;...

Embodiment 3

[0080] Example 3 Study on Changes in the Expression of Apoptosis-Related Genes

[0081] 1. Primer design

[0082] The sequences of the internal reference β-Actin and the apoptosis-related genes Bax and Bcl-2 were queried on Genbank, and primers (see the sequence in Table 2) were designed using the primer5.0 software, and synthesized by Dalian Bao Biological Engineering Co., Ltd.

[0083] Table 2

[0084] Gene

Primer

serial number

Sequence (5'to 3')

β-actin

upstream primer

1

TCTGGTGATGGTTGACCCA

downstream primer

2

GGTGAAGCTGTAGCCACGCT

Bcl-2

upstream primer

3

TCACTCAGTTCAGACCTCTCAT

downstream primer

4

ACGCTTTCCACGCACAT

Bax

upstream primer

5

GGCTATTTCAACCAGGGTTCC

downstream primer

6

TGCGAATCACCAATGCTGT

[0085] 2. Extraction of total RNA and synthesis of cDNA

[0086] 14 experimental groups: Group V, Group E, Group E+HWM12.5, Group E+HWM 25, Grou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Concentrationaaaaaaaaaa
Login to view more

Abstract

The invention relates to application of an oliveolea europaea L. leaf extractive to preparation of a drug for preventing and treating fetal alcohol syndrome, and belongs to the technical field of drugs for preventing and treating fetal alcohol syndrome. According to the application of the oliveolea europaea L. leaf extractive to preparation of the drug for preventing and treating fetal alcohol syndrome, a new purpose of the oliveolea europaea L. leaf extractive is provided. The inventor finds that the oliveolea europaea L. leaf extractive shows morphological protection for ethanol-induced zebra fish embryonic development toxicity, wherein the oliveolea europaea L. leaf extractive has a certain effect of apoptosis restraining on expression up-regulation of proapoptotic genes and expressiondown-regulation of apoptosis inhibiting genes in an ethanol-induced zebra fish embryonic body. It is found that the oliveolea europaea L. leaf extractive can lower morphologic change of ethanol-causedzebra fish embryonic development and restrain apoptosis, has a certain protecting function on zebra fish embryos, and provides a new method for preventing and treating fetal alcohol syndrome.

Description

technical field [0001] The invention relates to the application of olive leaf extract in the preparation of medicines for preventing and treating fetal alcohol syndrome, and belongs to the technical field of medicines for preventing and treating fetal alcohol syndrome. Background technique [0002] Fetal alcohol syndrome (fetal alcohol syndrome, FAS) is a series of syndromes of impaired fetal development caused by pregnant women's alcoholism during pregnancy. Due to the widespread existence of alcoholism, the proportion of newborns severely poisoned by alcohol is close to 1 / 200, and the proportion of moderately impaired is even higher. Modern medicine has made great breakthroughs in the study of the etiology and pathology of FAS, but specific drugs are still needed for treatment. [0003] The traditional experimental model for studying FAS is the mouse. Numerous studies have shown that ethanol-treated zebrafish embryos also exhibit similar FAS features during development, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K31/7048A61K36/63A61P25/00A61P25/32A61P3/00A61P39/00
CPCA61K31/7048A61K36/63A61P3/00A61P25/00A61P25/30A61P39/00
Inventor 王维香温巧李艳
Owner XIHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products