Application of olive leaf extract in the preparation of drugs for the prevention and treatment of fetal alcohol syndrome
A technology of olive leaf extract and syndrome, applied in the direction of drug combination, pharmaceutical formula, plant raw materials, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Preparation of olive leaf extract and morphological study on the protective effect on zebrafish embryos
[0039] 1. Preparation of olive leaf extract
[0040] (1) Sample pretreatment
[0041] Take the fresh olive leaves and dry them naturally in a cool, dry and ventilated place. After drying in the shade, dry them at 40°C to constant weight, crush them through a 60-mesh sieve, and use them as powder for later use.
[0042] (2) hot water extraction method
[0043] Weigh 100g of the powder, add 1L of pure water, extract at 55°C for 210min, centrifuge at 5000r / min for 10min after extraction, concentrate the supernatant to 100mL with a rotary evaporator, and freeze-dry to obtain the preparation HWE.
[0044] (3) Soxhlet extraction method
[0045] Weigh 100 g of the powder, add 3.5 L of 60% ethanol, conduct Soxhlet extraction at 80°C for 105 min, centrifuge at 5000 r / min for 10 min, concentrate the supernatant to 100 mL with a rotary evaporator, and freeze-dry t...
Embodiment 2
[0075] Example 2 Acridine Orange (AO) Fluorescent Staining Analysis to Detect Zebrafish Cell Apoptosis
[0076] 120hpf hatched larvae were stained with 7mg / L acridine orange at 28.5°C for 0.5h in the dark, then washed 3 times with embryo culture medium for 5min each time, anesthetized with 0.08% ethylene glycol phenyl ether for 2min, and placed under a fluorescent stereomicroscope for observation , take pictures, and use ImageJ software to analyze and measure the fluorescence intensity of larvae. See the result Figure 11 and Figure 12 .
[0077] Figure 11 To improve the acridine orange (AO) fluorescence staining results of 1.5% ethanol-treated zebrafish embryos / larvae at 120hpf for different olive leaf extracts; 12.5, 25 and 50 represent the concentration of olive leaf extract respectively, in mg / L; HWM: Olive leaf extract prepared by hot water extraction; SE: olive leaf extract prepared by Soxhlet extraction; UAE: olive leaf extract prepared with ultrasound assistance;...
Embodiment 3
[0080] Example 3 Study on Changes in the Expression of Apoptosis-Related Genes
[0081] 1. Primer design
[0082] The sequences of the internal reference β-Actin and the apoptosis-related genes Bax and Bcl-2 were queried on Genbank, and primers (see the sequence in Table 2) were designed using the primer5.0 software, and synthesized by Dalian Bao Biological Engineering Co., Ltd.
[0083] Table 2
[0084] Gene Primer serial number Sequence (5'to 3') β-actin upstream primer 1 TCTGGTGATGGTTGACCCA downstream primer 2 GGTGAAGCTGTAGCCACGCT Bcl-2 upstream primer 3 TCACTCAGTTCAGACCTCTCAT downstream primer 4 ACGCTTTCCACGCACAT Bax upstream primer 5 GGCTATTTCAACCAGGGTTCC downstream primer 6 TGCGAATCACCAATGCTGT
[0085] 2. Extraction of total RNA and synthesis of cDNA
[0086] 14 experimental groups: Group V, Group E, Group E+HWM12.5, Group E+HWM 25, Group E+HWM 50, Group E+SE12.5, Group E+SE25, Group E+SE 5...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap