Pharaoh cuttlefish neuropeptide sCAP and application thereof

A tabby squid and neuropeptide technology, applied in the field of neuropeptides, can solve the problems of less research on small molecule peptides, and achieve the effects of excellent immunity, reasonable design and convenient operation.

Inactive Publication Date: 2019-02-22
ZHEJIANG OCEAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] At present, the research on cephalopod neuropeptides mainly focuses on small molecular peptides such as GnRH, FaRPs and APGWamide, while the small molecular peptides that are of great significance in the process of physiological regulation - sCAP are less studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pharaoh cuttlefish neuropeptide sCAP and application thereof
  • Pharaoh cuttlefish neuropeptide sCAP and application thereof
  • Pharaoh cuttlefish neuropeptide sCAP and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] A tiger squid neuropeptide sCAP, the cDNA sequence of the sCAP gene has a total length of 666bp, including 109bp 5'-UTR, 296bp 3'-UTR and 261bp open reading frame ORF, encoding a total of 86 amino acids with a MW of 9.3kDa , pI8.52. The signal peptide is located between No. 1 and No. 20 amino acids. The protein contains an obvious transmembrane structure. The secondary structure analysis of the protein found that it contains 33.72% extended chains, 66.28% random coil structures, and hydrophilic Analysis showed that the protein contained 28 hydrophilic amino acids and 58 hydrophobic amino acids, which was a hydrophilic protein.

[0037] By qPCR expression analysis, the expression of the SpsCAP gene was clearly detected in the optic lobe of male and female tabby squid, followed by the brain, suggesting that sCAP controls its activity by controlling the nervous system of tabby squid. The trace expression of sCAP in ovary gland and paravertebral gland may be related to the...

Embodiment 2

[0231] Construction and identification of recombinant expression vectors:

[0232] Construction and identification of recombinant plasmids: According to the cDNA sequence of tiger squid neuropeptide sCAP, a pair of specific primers P1 and P2 were used to amplify the coding sequence of tiger squid neuropeptide sCAP. A restriction endonuclease site Kpn I and a sequence encoding an enterokinase cleavage site were introduced at the 5' end of the P1 primer, and a restriction endonuclease site Sac I and a stop codon coding were introduced at the 5' end of the P2 primer Sequence TCA, the sequences of the two primers are:

[0233] P1: GGTACCGACGATCCCTTGTAATCCGTTACGGATCTGTCCTCTCTGC

[0234] P2: GAGCTCTCATTTTCCAGTAATTCCAACGGGTTGTAGTTG;

[0235] The PCR reaction volume was 20 μl, and the amplification conditions were: 95° C. for 5 minutes; 35 cycles of 95° C. for 30 s, 65° C. for 30 s, and 73° C. for 30 s; 71° C. for 7 minutes. After the PCR product was detected by agarose electrophores...

Embodiment 3

[0237] Expression of recombinant expression of tabby squid neuropeptide sCAP gene:

[0238] 1. Induced expression of recombinant protein:

[0239] Introduce the recombinant vector obtained above into the host strain rosetta, use LB medium containing 120 μg / mL ampicillin, 42 μg / mL chloramphenicol and 8 μg / mL chloramphenicol for expansion culture, and use P1 and P2 as primers for PCR reaction , screen the engineering strain transformed into the correct recombinant expression vector and perform sequencing to verify that there is no base mutation. By adding μg / mL level of chlorbenzidine to the LB medium, it can effectively reduce the effect of chemical stimulation and biological stimulation on alkali The induction and stimulation of gene mutations can increase the proportion of non-mutated engineering strains, so that the recombinant protein can be efficiently induced and expressed.

[0240] 2. Expanded cultivation and collection of engineered bacteria expressing recombinant neur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a pharaoh cuttlefish neuropeptide sCAP and an application thereof, and belongs to the technical field of neuropeptides. The cDNA sequence with the total length of 666bp of a sCAP gene includes 5'-UTR of 109bp, 3'-UTR of 296bp and an ORF (open reading frame) of 261bp, 86 amino acids are totally encoded, and MW is 9.3kDa, pI 8.52. A vector with the neuropeptide sCAP gene is constructed, induction expression is implemented after host bacteria rosetta are introduced, recombination proteins are collected after enlarging cultivation is implemented, and the vector can be applied to reproduction control of pharaoh cuttlefish. The neuropeptide sCAP has the advantages that after the pharaoh cuttlefish is fed or sprayed by solution with the recombination proteins of the pharaohcuttlefish sCAP gene, action capacity, feeding capacity and immune capacity of the pharaoh cuttlefish are more excellent, and the neuropeptide sCAP has guiding significances for reproduction controlapplication in the aquaculture process of the pharaoh cuttlefish.

Description

technical field [0001] The invention belongs to the technical field of neuropeptides, and in particular relates to the tiger squid neuropeptide sCAP and its application. Background technique [0002] At present, the research on cephalopod neuropeptides mainly focuses on small molecular peptides such as GnRH, FaRPs and APGWamide, while the small molecular peptides that are of great significance in the process of physiological regulation-sCAP are less studied. Lloyd et al. were the first to identify the distribution characteristics of CAP in the mollusk snail. sCAP plays an important role in physiological processes such as stimulating heart movement, controlling muscle contraction, fallopian tube contraction, enhanced intestinal contraction and biological molting. In cephalopods, sCAP was first discovered in the brain tissue of Octopus minor, and there are four types of sCAP, Ocp-1, Ocp-2, Ocp-3 and Ocp-4. Its related analog oct-SCPRP is also found in octopuses, which has th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/70A23K20/147
CPCA23K20/147C07K14/43504C12N15/70
Inventor 迟长凤李颖黄伟刘慧慧吕振明
Owner ZHEJIANG OCEAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap